Primer sequence

RNA isolation was performed in human and rat liver tissue, as well as in cell cultures, using TRI Reagent (Sigma). Subsequently, reverse transcription and quantitative real-time PCRs (qPCRs) were carried out as described in the Supplementary data. Expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as normalizing control. Primer sequences (Sigma) are included in Table S2 and the supplementary CTAT table.

Total RNA from mouse liver, muscle, gonadal WAT, placenta, fetal liver, and human
placenta was processed (27 (link)). Primer sequences
(Sigma-Aldrich, Poole, United Kingdom) are provided in Supplemental Table S1.

Relative mRNA expression was measured using qRT-PCR [13 (link)]. Briefly, total RNA was isolated from samples using a High Pure RNA Isolation Kit (Roche, Switzerland). A total of 200 ng RNA was reverse transcribed to cDNA. Relative expression of mRNA was determined using a OneTaq® RT-PCR Kit (BioLabs, USA) and calculated using 2^−ΔΔCT method. Primer sequences (Sigma-Aldrich) used in this study are as follows: KDM2B forward, 5’-TCTACGAGATCGAGGACAGGA-3’ and reverse, 5’-ACCAGCACATCTCATAGTAGAAGG-3’; and β-actin forward, 5’- CTCGACACCAGGGCGTTATG-3’ and reverse, 5’- CCACTCCATGCTCGATAGGAT-3’.

Real-time PCR was performed in sealed 96-well microplates using a LightCycler FastStart DNA Master SYBR Green kit and a LightCycler instrument (Hoffman-La Roche Ltd., Basel, Switzerland) as previously described [59 (link)]. The assay was performed in a 50 μL sample containing a reaction mixture of 20 ng of DNA, with 25 μL of SsoAdvanced Universal SYBR Green (Bio-Rad, Hercules, CA, USA), 5 μL of each primer, and 10 μL of water. Primer sequences (Sigma-Aldrich, St. Louis, MO, USA) used to target the 16S rRNA gene of the bacteria and the conditions for PCR amplification reactions are listed in Table 1. To verify the specificity of the amplicon, a melting curve analysis was performed via monitoring SYBR Green fluorescence in the temperature ramp from 60 °C to 97 °C. Data were processed and analyzed using the LightCycler software (Hoffman-La Roche Ltd., Basel, Switzerland). Standard curves were constructed using serial tenfold dilutions of bacterial genomic DNA, according to the data provided on the following webpage (http://cels.uri.edu/gsc/cndna.html). Bacterial genomic DNA (DSMZ, Braunschweig, Germany) was used as a standard. Genome size and the copy number of the 16S rRNA gene for each bacterial strain used as a standard were obtained from the NCBI Genome database (www.ncbi.nlm.nih.gov). Data are presented as the mean values of duplicate PCR analysis.

FACS-sorted cells were resuspended in RNA lysis buffer (Zymo Research, Irvine, CA) and stored at − 80 °C until RNA isolations were performed using the ZR RNA isolation kit (Zymo Research), according to the manufacturer’s instructions. The RNA was treated with DNAase I (amplification grade; Invitrogen) to remove any genomic DNA before being reverse-transcribed into cDNA, as described elsewhere [40 ]. To check for genomic DNA contamination control samples without reverse transcriptase were included. cDNA was stored at − 20 °C until further use. Real-time PCR was performed on a CFX96 system (Bio-Rad, Veenendaal, Netherlands) using SYBR Green reaction mix (Sigma-Aldrich) and Siglec expression was calculated relative to GAPDH expression. Primer sequences (Sigma-Aldrich) were derived from the Harvard Primer Bank database (Supplementary Table 1) [41 (link)].

Total RNAs were extracted using an Arcturus® Picopure® RNA Isolation Kit and were reversely transcribed to cDNAs using a SuperScript® First-Strand Synthesis System according to the manufacture’s instructions. Real-time PCR was performed using a Power SYBR® Green Master Mix on a 7300 real-time PCR System. Reagents and kits for PCR were all purchased from Life Technologies. Data were analyzed on 7300 system software. Primer sequences (Sigma-Aldrich, St. Louis, MO, USA) for each gene were shown as follows:
The accession number of target genes is IL-10: NM_010548.2, TGF-beta: NM_011577.1, ebi3: NM_015766.2, Beta-actin: NM_007393.4.

The analysis of gene expression was performed as previously described^{28 (link),48 (link)}. Briefly, total RNA was isolated with the ReliaPrep^™ RNA Tissue Miniprep System (Promega, Mannheim, Germany) according to the manufacturer´s instructions. Five-hundred nanogram RNA were reverse transcribed by using the M-MLV Reverse Transcriptase (Promega, Mannheim, Germany) and the complementary DNA (cDNA) was used for a SYBR green-based real-time PCR. A standard protocol was used for the analysis of gene expressions (Applied Biosystems, Carlsbad, CA, USA). The primer sequences (Sigma-Aldrich) for human genes were as follows: FDPS: CAGAATGAACGGAGACCAGA, GGGAGAAGTGCTGAACGAAA; GAPDH (glyceraldehyde 3-phosphate-dehydrogenase): AGCCACATCGCTCAGACAC, GCCCAATACGACCAAATCC; HMGCR: AGGAGGCATTTGACAGCACT, ACCTGGACTGGAAACGGATA; LDLR: GTGCTCCTCGTCTTCCTTTG, GTGGACCTCATCCTCTGTGG.