Log In Sign up
The largest database of trusted experimental protocols

Ab74272

Manufactured by Abcam
Visit Supplier
Sourced in United Kingdom, United States, China

Ab74272 is a primary antibody product from Abcam. It is a rabbit monoclonal antibody that recognizes an epitope within the N-terminal region of the human ACAT1 protein.

Automatically generated - may contain errors

Lab products found in correlation

Protein g magnetic beads, by Thermo Fisher Scientific (4 mentions) Ab32500, by Abcam (3 mentions) Ab108525, by Abcam (2 mentions) Ba3433 2, by Boster Bio (2 mentions) Pierce agarose chip kit, by Thermo Fisher Scientific (2 mentions) Citrate buffer, by BioGenex (2 mentions) Ab17230, by Abcam (2 mentions) Hoechst 33342, by Thermo Fisher Scientific (2 mentions) Ab181603, by Abcam (1 mentions) Ab191401, by Abcam (1 mentions) Bca kit, by Keygen Biotech (1 mentions) Ab32138, by Abcam (1 mentions) Abt 888, by Selleck Chemicals (1 mentions) Bicalutamide, by Selleck Chemicals (1 mentions) Dimethyl sulfoxide (dmso), by Merck Group (1 mentions) Cell apoptosis detection kit, by Keygen Biotech (1 mentions) Dab substrate, by Merck Group (1 mentions) Anti ar n 20, by Santa Cruz Biotechnology (1 mentions) Protein a g magnetic dynabeads, by Thermo Fisher Scientific (1 mentions) Ab182576, by Abcam (1 mentions)

41 protocols using ab74272

1

Protein Quantification and Western Blotting

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were prepared using a RIPA lysis buffer containing a protease inhibitor cocktail. The protein concentrations were quantified with the BCA kit (All kits from KeyGen Biotech). Subsequent experiment was conducted as recently described (26 (link)). The antibodies used for western blotting were as follows: Rabbit anti-BCL11A (ab191401, 1:10,000, Abcam), rabbit anti-AR (ab74272, 1:300, Abcam), rabbit anti-GAPDH (ab181603, 1:10,000, Abcam) and rabbit IgG (#7074, 1:10,000, Cell Signaling Technologies, Inc.).
Wang X., Xu Y., Xu K., Chen Y., Xiao X, & Guan X. (2020). BCL11A confers cell invasion and migration in androgen receptor-positive triple-negative breast cancer. Oncology Letters, 19(4), 2916-2924.
+ Open protocol
+ Expand
2

ChIP Assay for Chromatin Immunoprecipitation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed as described previously 48 (link). Briefly, mouse tissues were minced and incubated with 1% formaldehyde for 15 min and quenched with 0.150 M glycine for 10 min. Samples were washed sequentially with cold PBS, and resuspended in cell lysis buffer (50 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40, and 0.25% Triton X-100), and then homogenized. The chromatin was sheared in nuclear lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5 mM EGTA, and 0.2% SDS) to an average size of 200–500 bp by sonication, and then diluted 3-fold in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, and 167 mM NaCl), and was subjected to immunoprecipitation by magnetic protein G beads (Invitrogen) conjugated with AR (ab74272, abcam) or β-catenin antibody (610154, BD Biosciences). Cross-links were reversed and chromatin DNA fragments were analyzed by real-time qPCR with specific primers (Supplemental Table 9).
He Y., Mi J., Olson A., Aldahl J., Hooker E., Yu E.J., Le V., Lee D.H., Kim W.K., Robins D.M., Geradts J, & Sun Z. (2020). ANDROGEN RECEPTOR WITH SHORT POLYGLUTAMINE TRACT PREFERABLY ENHANCES WNT/β-CATENIN MEDIATED PROSTATIC TUMORIGENESIS. Oncogene, 39(16), 3276-3291.
+ Open protocol
+ Expand
3

ChIP-qPCR for Protein-DNA Interactions

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed as described previously 37 (link). Briefly, mouse tissues were minced and incubated with 1% formaldehyde for 15 min and quenched with 0.150 M glycine for 10 min. Samples were washed sequentially with cold PBS, and resuspended in cell lysis buffer (50 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40, and 0.25% Triton X-100), and then homogenized. The chromatin was sheared in nuclear lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5 mM EGTA, and 0.2% SDS) to an average size of 200–500 bp by sonication, and then diluted 3-fold in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, and 167 mM NaCl), and was subjected to immunoprecipitation by magnetic protein G beads (Invitrogen) conjugated with AR (ab74272, abcam) or SOX2 antibody (39843, Active Motif). Cross-links were reversed and chromatin DNA fragments were analyzed by real-time qPCR with specific primers (Supplemental Table 3).
He Y., Johnson D.T., Yang J.S., Wu H., You S., Yoon J., Lee D.H., Kim W.K., Aldahl J., Le V., Hooker E., Yu E.J., Geardts J., Cardiff R.D, & Sun Z. (2019). LOSS OF THE TUMOR SUPPRESSOR, TP53, ENHANCES THE ANDROGEN RECEPTOR MEDIATED ONCOGENIC TRANSFORMATION AND TUMOR DEVELOPMENT IN THE MOUSE PROSTATE. Oncogene, 38(38), 6507-6520.
+ Open protocol
+ Expand
4

ChIP-qPCR for Protein-DNA Interactions

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed as described previously 37 (link). Briefly, mouse tissues were minced and incubated with 1% formaldehyde for 15 min and quenched with 0.150 M glycine for 10 min. Samples were washed sequentially with cold PBS, and resuspended in cell lysis buffer (50 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40, and 0.25% Triton X-100), and then homogenized. The chromatin was sheared in nuclear lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.5 mM EGTA, and 0.2% SDS) to an average size of 200–500 bp by sonication, and then diluted 3-fold in ChIP dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, pH 8.1, and 167 mM NaCl), and was subjected to immunoprecipitation by magnetic protein G beads (Invitrogen) conjugated with AR (ab74272, abcam) or SOX2 antibody (39843, Active Motif). Cross-links were reversed and chromatin DNA fragments were analyzed by real-time qPCR with specific primers (Supplemental Table 3).
He Y., Johnson D.T., Yang J.S., Wu H., You S., Yoon J., Lee D.H., Kim W.K., Aldahl J., Le V., Hooker E., Yu E.J., Geardts J., Cardiff R.D, & Sun Z. (2019). LOSS OF THE TUMOR SUPPRESSOR, TP53, ENHANCES THE ANDROGEN RECEPTOR MEDIATED ONCOGENIC TRANSFORMATION AND TUMOR DEVELOPMENT IN THE MOUSE PROSTATE. Oncogene, 38(38), 6507-6520.
+ Open protocol
+ Expand
5

Bicalutamide and ABT-888 Synergistic Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bicalutamide and ABT-888 with a purity of 99% were purchased from Selleck Chemicals. Dihydrotestosterone (DHT), 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyl tetrazolium bromide (MTT) and dimethyl sulfoxide (DMSO) were from Sigma Chemicals. DHT was dissolved in ethanol at 0.1μM concentration, Bicalutamide and ABT-888 were dissolved in DMSO at 10 μM concentration. Cell Apoptosis Detection Kit was a product of KeyGEN Biotech, CA. The antibodies used included the following: AR (Abcam, ab74272), PARP1 (Abcam, ab32138). All culture media and serum were obtained from GIBCO/BRL Life Technologies, Inc.
Luo J., Jin J., Yang F., Sun Z., Zhang W., Shi Y., Xu J, & Guan X. (2016). The Correlation Between PARP1 and BRCA1 in AR Positive Triple-negative Breast Cancer. International Journal of Biological Sciences, 12(12), 1500-1510.
+ Open protocol
+ Expand
6

Immunohistochemical analysis of breast cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human breast cancer tissue microarrays (BR20810, US Biomax) were deparaffinized and subject to antigen retrieval in 10 mM citrate buffer (pH 6.0) for 10 minutes in a pressure cooker. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 15 minutes. Sections were blocked in 5% goat serum in PBS for an hour and incubated with either Sox10 (NBP2-44474, Novus) or AR (ab74272, abcam) primary antibody overnight at 4°C followed by incubation with the appropriate HRP-conjugated secondary at room temperature for 30 minutes. Antibodies were incubated in blocking solution. Sections were then incubated in DAB substrate (Sigma Aldrich) and counterstained with Haematoxylin. Sections were dehydrated in ethanol prior to clearing in xylene before mounting the slides. Positive pixels were enumerated using an Aperio Scanscope.
Al-Zahrani K.N., Cook D.P., Vanderhyden B.C, & Sabourin L.A. (2018). Assessing the efficacy of androgen receptor and Sox10 as independent markers of the triple-negative breast cancer subtype by transcriptome profiling. Oncotarget, 9(70), 33348-33359.
+ Open protocol
+ Expand
7

Protein Subcellular Fractionation and Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein subcellular fractionation isolation was following the instruction provided in the kit as previously described [7 (link)]. 500–1000 μg of protein was subjected to immunoprecipitation using 2.5 μg of rabbit polyclonal antibody, anti-AR N-20 (Santa Cruz Biotechnology) and 2.5 μg of rabbit polyclonal antibody, anti-AR (ab74272, Abcam). After separation of immunoprecipitated proteins using magnetic protein A/G Dynabeads (Invitrogen), pellets were washed by lysis buffer (containing 150 mM NaCl, 5 mM MgCl2, 2 mM EGTA, 50 mM Tris-HCl, and 1% Triton X-100) three times, 5 min each. Proteins were disassociated from the magnetic beads by incubating with 0.1 M glycine (pH 2.2–2.7) for 10 min. A part of co-IP samples was sent to FitGene Biotechnology Co. Ltd. (Guangzhou, China) for mass spectrometry (MS) detection and bioinformatic analysis, and the other was for Western blot analysis.
Deng Q., Zhang J., Wang Z., Zhang S., Zhi F, & Liang H. (2018). Vesicle-Associated Membrane Protein-Associated Protein A Is Involved in Androgen Receptor Trafficking in Mouse Sertoli Cells. International Journal of Endocrinology, 2018, 4537214.
+ Open protocol
+ Expand
8

Protein Interactions in Cellular Processes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Western blot and coimmunoprecipitation analyses were conducted as described in our previous research.9 (link) Antibodies against the following proteins were used: gankyrin (ab182576, Abcam), HMGB1 (ab18256, Abcam), STAT3 (ab32500, Abcam), p-STAT3 (ab76315, Abcam), NONO (11058, Proteintech), AR (ab74272, Abcam), and GAPDH (#2118S, CST). To analyze gankyrin, HMGB1 and NONO protein interactions, co-immunoprecipitation assays were used with antibodies against the following: gankyrin (ab182576, Abcam), HMGB1 (ab18256, Abcam), and NONO (11058, Proteintech). The GAPDH was utilized as an internal reference.
Peng G., Wang C., Wang H., Qu M., Dong K., Yu Y., Jiang Y., Gan S, & Gao X. (2023). Gankyrin-mediated interaction between cancer cells and tumor-associated macrophages facilitates prostate cancer progression and androgen deprivation therapy resistance. Oncoimmunology, 12(1), 2173422.
+ Open protocol
+ Expand
9

Genome-wide Profiling of AR Binding in VCaP Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Treated VCaP cells were processed as described for genome-wide determination of AR peaks using the specific antibody ab74272 (Abcam, Cambridge, UK) [13 (link)]. The experiments were performed in biological triplicate, and the libraries were prepared for sequencing on a HiSeq2500 Illumina machine followed by mapping to the human genome hg19. Details on the bioinformatics analysis have been published [13 (link)], and raw and processed data are available under GSE148358.
Nevedomskaya E., Sugawara T., Baumgart S.J., Lesche R., Hahne H., Mumberg D, & Haendler B. (2022). Comparative Proteomic and Transcriptomic Analysis of the Impact of Androgen Stimulation and Darolutamide Inhibition. Cancers, 15(1), 2.
+ Open protocol
+ Expand
10

Chromatin Immunoprecipitation and Luciferase Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chromatin immunoprecipitation analysis and luciferase reporter assays were performed in our previous study.9 (link) The following antibodies were applied including AR (ab74272, Abcam) and STAT3 (ab32500, Abcam) antibodies. Rabbit anti-IgG antibodies (2729, CST) served as a negative control. RT-PCR was performed with specific primers flanking the AR-binding site (forward: 5’- TGGAAGCCGAGGAACAGGGTCA −3’; reverse: 5’- GCGTGGAGATGGGCAGGGTTAA −3’) in the HMGB1 promoter and the STAT3-binding site (forward: 5’-TCCAGAGTGAGGTTCAGCCTTT-3’; reverse: 5’- CTCTAGGCCATCCTGCCTTTCT-3’) in the gankyrin promoter.
The AR-binding sites of the HMGB1 promoter (sequence: AGGAACAGGGTCAGC, +1159 to +1173 from the HMGB1 transcription site) and the STAT3-binding sites of the gankyrin promoter (sequence: CTGTTTAGAAA, +177 to +187 from to the gankyrin transcription site) or their mutant sequences were cloned into the pGL3-basic luciferase reporter vector; the pRL-TK Renilla luciferase plasmid (Promega, USA) was applied for transfection efficiency normalization. Cells were harvested at 2 day after transfection, and HMGB1 and gankyrin transcription activities were calculated via detecting luminescence with a Dual-Luciferase Assay Kit (Promega, USA). The fold induction value was calculated relative to Renilla luciferase activity.
Peng G., Wang C., Wang H., Qu M., Dong K., Yu Y., Jiang Y., Gan S, & Gao X. (2023). Gankyrin-mediated interaction between cancer cells and tumor-associated macrophages facilitates prostate cancer progression and androgen deprivation therapy resistance. Oncoimmunology, 12(1), 2173422.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!