Celltac hematology analyzer

Manufactured by Nihon Kohden

Sourced in Japan

The Celltac hematology analyzer is a compact and automated blood cell counter designed for complete blood count (CBC) analysis. It provides accurate and reliable measurement of red blood cells, white blood cells, and platelets in a small volume of blood sample.

Automatically generated - may contain errors

Lab products found in correlation

Celltac α, by Nihon Kohden (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Elisa kit, by Thermo Fisher Scientific (1 mentions) Mek 6550j k, by Nihon Kohden (1 mentions) Cfx real time pcr detection system, by Bio-Rad (1 mentions) Quantitect reverse transcription system, by Qiagen (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions) Percoll, by Thermo Fisher Scientific (1 mentions) Histopaque 1119, by Merck Group (1 mentions) Rpmi 1640, by Thermo Fisher Scientific (1 mentions) Percoll, by GE Healthcare (1 mentions) Diff quik stain, by Sysmex (1 mentions)

7 protocols using celltac hematology analyzer

Arterial Blood and Plasma Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animals concentration, and base excess of arterial blood drawn from the femoral artery were analyzed using an i-STAT300F blood gas analyzer (FUSO Pharmaceutical Industries, Osaka, Japan).
Venous blood from the postcaval vein was collected and centrifuged to measure plasma levels of potassium (K + ), blood urea nitrogen (BUN), creatinine (Cre), and creatine phosphokinase (CPK) (measurements were carried out by SRL Inc., Tokyo, Japan). Methemoglobin (Met-Hb) was measured as previously described (7) . Platelets were measured using a Celltac hematology analyzer (Nihon Kohden Co., Tokyo, Japan), and the levels of von Willebrand factor (vWF) were measured using a rat vWF enzyme-linked immunosorbent assay (ELISA) kit (USCN, Houston, TX, USA). Nitrite (NO2 -) concentrations in muscle and plasma were measured with CII and FX NO2 -/nitrate (NO3 -) assay kits (Dojindo Laboratories, Tokyo, Japan) according to the manufacturer's instructions. Plasma levels of interleukin (IL)-6 and -10 were measured using ELISA kits (Pierce Biotechnology, Rockford, IL, USA) according to the manufacturer's instructions.

Murata I., Miyake Y., Takahashi N., Suzuki R., Fujiwara T., Sato Y., Inoue Y., Kobayashi J, & Kanamoto I. (2017). Low-Dose Sodium Nitrite Fluid Resuscitation Prevents Lethality From Crush Syndrome by Improving Nitric Oxide Consumption and Preventing Myoglobin Cytotoxicity in Kidney in A Rat Model. Shock (Augusta, Ga.), 48(1).

+ Open protocol

+ Expand

Ferret Challenge Study of SFTSV

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vaccinated or control ferrets were challenged intramuscularly with 10^7.6 TCID₅₀ of the SFTSV CB1/2014 strain (0.5 mL in the outside of each thigh of both legs). Throughout the ferret challenge studies, we used a TCID₅₀ dose (~10^7.6) of SFTSV that caused 100% fatal infection in ferrets, as in our previous recent study^{18 (link)}. The survival of challenged ferrets was monitored for 14 days after lethal SFTSV challenge because our recently published study demonstrated that all aged-ferrets died within 10 days post-SFTSV challenge^{18 (link)}. Clinical signs of infection (viral load, platelet counts, WBC counts, ALT/AST levels, body weight, and body temperature) were monitored at 0, 2, 4, 6, and 8 days post challenge. However, if vaccinated ferrets showed any clinical signs of infection (based on platelet and WBC counts, body temperature, and/or body weight possibly due to partial protection by vaccination), they were monitored for their clinical symptoms for 14 days post challenge. Sera were collected from each ferret at 2-day intervals after infection and peripheral virus titers were determined. Hematological parameters were analyzed using EDTA-treated whole-blood samples from infected animals using the Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden). Biochemical parameters of serum from infected animals were determined using Celltac α (MEK-6550, Nihon Kohden).

Kwak J.E., Kim Y.I., Park S.J., Yu M.A., Kwon H.I., Eo S., Kim T.S., Seok J., Choi W.S., Jeong J.H., Lee H., Cho Y., Kwon J.A., Jeong M., Maslow J.N., Kim Y.E., Jeon H., Kim K.K., Shin E.C., Song M.S., Jung J.U., Choi Y.K, & Park S.H. (2019). Development of a SFTSV DNA vaccine that confers complete protection against lethal infection in ferrets. Nature Communications, 10, 3836.

+ Open protocol

+ Expand

Ferret Hematological Profile and Viral Titration

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We analyzed for hematological profile and tittered viremia as previously described (17 (link)). Total white blood cell and platelet counts in whole ferret blood samples were analyzed using the Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden, Japan). Total RNA was extracted with TRIzol reagent (ThermoFisher) and reverse-transcribed to generate cDNA using QuantiTect Reverse Transcription system (Qiagen). Primers for real-time RT PCR (F: AATTCACATTTGAGGGTAGTT), R: TATCCAAGGAGGATGACAATAAT) were designed to recognize M segment of DBV genome. Real-time PCR was performed with SYBR Green supermix and CFX Real-Time PCR detection system (Bio-Rad). Copy numbers were normalized to GAPDH gene.

Kim D., Kim E., Kim S., Chung Y., Lai C.J., Cha I., Cho S.D., Choi Y., Dai X., Kim S., Kang S., Kwak M.J., Liu Z., Choi Y., Park S.H., Choi Y.K, & Jung J.U. (2023). Self-assembling Gn head ferritin nanoparticle vaccine provides full protection from lethal challenge of Dabie Bandavirus in aged ferrets. bioRxiv.

+ Open protocol

+ Expand

Lethal SFTSV Challenge in Ferrets

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ferrets immunized with recombinant viruses or PBS-preimmunized control animals were challenged i.m. with 10^7.6 TCID₅₀ of CB1/2014 strain (0.5 mL in the outside of each thigh of both legs). Throughout the ferret challenge studies, we used a TCID₅₀ dose (∼10^7.6) of SFTSV. This dose is known to cause 100% fatality rate in infected ferrets, as seen in our recent study (40 (link)). Survival was monitored for 14 d after lethal SFTSV challenge with CB1/2014. Sera were collected from each ferret at 2-d intervals after infection and peripheral virus RNA copy numbers were determined. Hematological parameters were analyzed using EDTA-treated whole-blood samples from infected animals using the Celltac hematology analyzer (MEK-6550J/K; Nihon Kohden). Biochemical parameters of serum from infected animals were determined using Celltac α (MEK-6550; Nihon Kohden).

Yu K.M., Park S.J., Yu M.A., Kim Y.I., Choi Y., Jung J.U., Brennan B, & Choi Y.K. (2019). Cross-genotype protection of live-attenuated vaccine candidate for severe fever with thrombocytopenia syndrome virus in a ferret model. Proceedings of the National Academy of Sciences of the United States of America, 116(52), 26900-26908.

+ Open protocol

+ Expand

Ferret-to-Ferret SFTSV Transmission

Check if the same lab product or an alternative is used in the 5 most similar protocols

To demonstrate animal-to-animal transmission of SFTSV, ferrets (≥4Y, n = 3) were inoculated with the CB1/2014 SFTSV strain [17 ] at a titer of 10^6.0 fifty percent of tissue culture infective dose (TCID₅₀)/mL by the intramuscular (IM) route, and direct contact (DC) and indirect contact (IC) ferret groups (n = 6/group) were introduced into the cages at 2 days postinfection (dpi), which is the initial day postcontact (dpc). Inoculated and DC ferrets were kept in direct contact in the same cage, whereas IC ferrets were separated from inoculated animals by a partition, which allowed air to move but did not allow direct contact between animals. Blood, fecal, nasal wash, saliva, and urine samples were collected every other day for 22 days from each group of ferrets to detect CB1/2014 SFTSV. Further, to investigate whether each collected specimen contained infectious live virus, groups of ferrets (≥4Y, n = 3/group) were treated with specimens (serum, fecal, nasal washes, saliva, and urine) by the oro-nasal route. Ferrets were then monitored for clinical symptoms, platelet numbers, and viral titers in body secretions. In addition, 500-μL blood samples were collected in EDTA tubes (MEDISTAR, Seoul, Korea) followed by analysis of hematological parameters using a Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden, Japan).

Yu K.M., Jeong H.W., Park S.J., Kim Y.I., Yu M.A., Kwon H.I., Kim E.H., Kim S.M., Lee S.H., Kim S.G, & Choi Y.K. (2019). Shedding and Transmission Modes of Severe Fever With Thrombocytopenia Syndrome Phlebovirus in a Ferret Model. Open Forum Infectious Diseases, 6(8), ofz309.

+ Open protocol

+ Expand

Murine Neutrophil Isolation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each mouse, 20 μL of blood was analyzed to count the number of white blood cells (WBCs) using the Celltac hematology analyzer (MEK-6308; Nihon Kohden, Tokyo, Japan).
For neutrophil isolation, blood was collected from each mouse followed by separation with centrifugation for 20 minutes at 800 g using Histopaque-1119 (Sigma-Aldrich, St. Louis, MO, USA). The neutrophil-rich phase was collected, washed in PBS, and separated by discontinuous density-gradient centrifugation in Percoll (GE Healthcare, Buckinghamshire, UK), as previously described [22 (link)]. Subsequently, the neutrophils were collected from the 70–75% layer of the Percoll gradient and washed with PBS; after hypotonic lysis with 0.2% and 1.6% NaCl solutions to remove residual erythrocytes, the cells were resuspended in RPMI-1640 (Invitrogen, Waltham, MA, USA). Purity and viability were routinely assessed using Diff-Quik stain (Sysmex, Kobe, Japan) and trypan blue stain (Wako Pure Chemical Industries, Osaka, Japan), respectively, under a microscope.

Hamaguchi S., Akeda Y., Yamamoto N., Seki M., Yamamoto K., Oishi K, & Tomono K. (2015). Origin of Circulating Free DNA in Sepsis: Analysis of the CLP Mouse Model. Mediators of Inflammation, 2015, 614518.

+ Open protocol

+ Expand

Hematology and Serum Biochemistry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Haematological parameters were analysed in EDTA-treated whole blood from infected animals using the Celltac hematology analyzer (MEK-6550J/K, Nihon Kohden). Biochemical parameters of serum from infected animals were determined using Celltac-α (MEK-6550, Nihon Kohden).

Park S.J., Kim Y.I., Park A., Kwon H.I., Kim E.H., Si Y.J., Song M.S., Lee C.H., Jung K., Shin W.J., Zeng J., Choi Y., Jung J.U, & Choi Y.K. (2018). Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis. Nature microbiology, 4(3), 438-446.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!