The largest database of trusted experimental protocols

Paav nefcas9

Manufactured by Addgene

The PAAV-nEFCas9 is a plasmid that contains a Cas9 gene driven by the ubiquitous EF1α promoter. It is designed for the expression of Cas9 protein in mammalian cells. The plasmid also includes a nuclear localization signal to facilitate the transport of Cas9 into the cell nucleus.

Automatically generated - may contain errors

2 protocols using paav nefcas9

1

Simple Template Vector for Knock-in

Check if the same lab product or an alternative is used in the 5 most similar protocols
To facilitate the generation of knock-in constructs, we developed a simple template vector (pORANGE). For this, we used pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene 62988) and replaced SpCas9puro by SpCas9 from pAAV-nEFCas9 (Addgene 87115) flanked by the bipartite SV40 nuclear localization signal (NLS) sequences using the AgeI and EcoRI restriction sites, generating pSpCas9. To facilitate cloning of donor sequences, a multiple cloning site was inserted by annealing two complementary DNA oligos and ligation into the XbaI site of pSpCas9 generating pORANGE.
+ Open protocol
+ Expand
2

CRISPR-Mediated Myh6 Knock-in Strategy

Check if the same lab product or an alternative is used in the 5 most similar protocols
The gRNA cloning plasmid (gRNA_cloning vector), GFP-expression self-complementary AAV plasmid (pscAAV-CAG-GFP), GFP-containing plasmid (pCAG-1BPNLS-Cas9-1BPNLS-2AGFP), Cas9-expression AAV plasmid (pAAV-nEFCas9), and AAV donor backbone plasmid (pAAV-rMERTK-HITI) were obtained from Addgene (Addgene 41824, 83279, 87109, 87115, and 87119, respectively). To construct the myosin heavy chain 6 (Myh6) target gRNA-expression vector (mMyh6-gRNA), we designed the Myh6 target sequence (20 bp target and 3 bp PAM sequence (underlined)) as follows: GCAGCAGAAGATGCACGACGAGG. The Myh6 target was subcloned into the gRNA_cloning vector according to a previously reported protocol (https://media.addgene.org/data/93/40/adf4a4fe-5e77–11e2–9c30–003048dd6500.pdf (20 April 2020, date last accessed)) with the primers 5′- TGGCTTTATATATCTT
GTGGAAAGGACGAAACACCGCAGCAGAAGATGCACGACG-3′ and 5′- GCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGTCGTGCATCTTCTGCTGC-3′. To construct a donor/gRNA AAV backbone plasmid (pAAV-Myh6GFP-HITI) for GFP knock-in at the Myh6 locus, U6-mMyh6gRNA and mMyh6GFP-HITI fragments were amplified from mMyh6-gRNA and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP, respectively, using PrimeSTAR GXL DNA polymerase (Takara Bio, Inc., Shiga, Japan). These PCR fragments were subcloned into pAAV-rMERTK-HITI using an In-fusion HD Cloning Kit (Takara Bio, Inc.).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!