Log In Sign up
The largest database of trusted experimental protocols

Anti rabbit magnetic beads

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

Anti-rabbit magnetic beads are a laboratory reagent used for the isolation and purification of target proteins or molecules from complex biological samples. The beads are coated with antibodies specific to rabbit proteins, allowing for the selective capture and separation of rabbit-derived materials through the use of a magnetic field.

Automatically generated - may contain errors

Lab products found in correlation

Control rabbit igg, by Santa Cruz Biotechnology (1 mentions) P akt, by Cell Signaling Technology (1 mentions) β actin, by Abcam (1 mentions) Protease phosphatase inhibitor cocktail, by Thermo Fisher Scientific (1 mentions) Anti mertk antibody, by Cell Signaling Technology (1 mentions) Dead cell removal kit, by Miltenyi Biotec (1 mentions)

Spelling variants of this product

Magnetic beads (264 citations)

4 protocols using anti rabbit magnetic beads

1

ChIP-qPCR protocol for FoxO1 transcription factor

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, ~10×106 cells were crosslinked with 1% formaldehyde and quenched with 0.125M glycine as previously described (Ouyang et al., 2012 (link)). Nuclei were isolated using 0.1% Triton buffer, and sonicated in SDS lysis buffer using to ~300-500bp size. 5ug of antibody was complexed overnight to anti-rabbit magnetic beads (Invitrogen), and 100ug of chromatin was used per immunoprecipitation (IP) reaction. FoxO1 ChIP antibody (ab39670) was obtained from Abcam. Control rabbit-IgG was obtained from Santa Cruz Biotechnology. Samples were washed with low salt, high salt, LiCl, and TE buffers, eluted with SDS and reverse crosslinked overnight, followed by proteinase K digestion, and DNA purification. Samples were then subjected to quantitative PCR using published primer sets (Oestreich et al., 2008 (link)). A region outside of the promoter region ‘X-region’ was used as a negative control (forward, 5′ CAGTATGCAGCTCCTGTCTCC 3′; reverse, 5′ ACACCATGACCAAACCCAAG 3′), and FoxO1 KO P14 CTLs were used to control for antibody-IP specificity. Fold enrichment was calculated over rabbit IgG control.
Staron M.M., Gray S.M., Marshall H.D., Parish I.A., Chen J.H., Perry C.J., Cui G., Li M.O, & Kaech S.M. (2014). The transcription factor FoxO1 sustains expression of the inhibitory receptor PD-1 and survival of antiviral CD8+ T cells during chronic infection. Immunity, 41(5), 802-814.
+ Open protocol
+ Expand
2

MerTK-mediated Phagocytosis Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies for immunoblotting were pAKT (Cell signaling, Catalog 4060S), AKT (Cell signaling, Catalog 4691S), β-Actin (Abcam, Catalog ab8226), MerTK (Genentech, clone 13D8 and 14C9) and phosphotyrosine (EMD, Catalog 05–321). For immunoprecipitation, anti-MerTK antibody (Cell signaling, Catalog 4319S) was conjugated to anti-rabbit magnetic beads (Invitrogen, Catalog 11203D) and rotated overnight. M0 macrophages were serum starved for 2 hours. Dead/apoptotic cells from Raji cell culture were depleted using a dead cell removal kit (Miltenyi Biotec, Catalog 130-090-101). Cells with viability more than 95% (as determined by Vi-Cell) were used. Raji cells in serum-free media were incubated with anti-CD20/18G7 hIgG1-LALAPG at 5 ug/ml for 1 hour at room temperature. Raji cell-antibody mixture were added to macrophages and incubated at 37°C for 30 minutes. After, incubation cells were washed twice with phosphate-buffered saline (PBS) and macrophages were lysed through sonication with RIPA buffer (Thermo Fisher, Catalog 89901) supplemented with protease/phosphatase inhibitor cocktail (Thermo Fisher, Catalog 1861281). Lysates were combined with anti-MerTK–conjugated magnetic beads and rotated for 2 hours at 4°C. Beads were washed 3 times with RIPA buffer and immunoblotted.
Kedage V., Ellerman D., Chen Y., Liang W.C., Borneo J., Wu Y, & Yan M. (2019). Harnessing MerTK agonism for targeted therapeutics. mAbs, 12(1), 1685832.
+ Open protocol
+ Expand
3

Immunoprecipitation of SMARCA5 from Nucleus Accumbens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti–SMARCA5 antibody (Bethyl A301–018A, TX, USA) was incubated overnight with anti–rabbit magnetic beads (Invitrogen) at 4°C. Frozen NAc tissue was homogenized in 100 μl of RIPA buffer as above with plastic pestles, and combined with 220 μl of immunoprecipitation buffer containing 16.7 mM Tris, 167 mM NaCl, 1.2 mM EDTA, 0.01% SDS, 1.1% Triton X–100, and protease inhibitors. The antibody–bead mixture was then added to the tissue lysate, and incubated overnight at 4°C. Following 3 washes with buffer containing 20 mM Tris, 150 mM NaCl, 2 mM EDTA, 1% Triton X–100, and 0.1% SDS, the pulldown was dissociated from the beads with elution buffer (50 mM Tris, 10 mM EDTA, 1% SDS) at 65°C and analyzed by Western blotting as described above.
Sun H., Damez–Werno D.M., Scobie K.N., Shao N., Dias C., Rabkin J., Koo J.W., Korb E., Bagot R.C., Ahn F.H., Cahill M.E., Labonté B., Mouzon E., Heller E.A., Cates H., Golden S.A., Gleason K., Russo S.J., Andrews S., Neve R., Kennedy P.J., Maze I., Dietz D.M., Allis C.D., Turecki G., Varga–Weisz P., Tamminga C., Shen L, & Nestler E.J. (2015). ACF chromatin remodeling complex mediates stress–induced depressive–like behavior. Nature medicine, 21(10), 1146-1153.
+ Open protocol
+ Expand
4

Immunoprecipitation of SMARCA5 from Nucleus Accumbens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Anti–SMARCA5 antibody (Bethyl A301–018A, TX, USA) was incubated overnight with anti–rabbit magnetic beads (Invitrogen) at 4°C. Frozen NAc tissue was homogenized in 100 μl of RIPA buffer as above with plastic pestles, and combined with 220 μl of immunoprecipitation buffer containing 16.7 mM Tris, 167 mM NaCl, 1.2 mM EDTA, 0.01% SDS, 1.1% Triton X–100, and protease inhibitors. The antibody–bead mixture was then added to the tissue lysate, and incubated overnight at 4°C. Following 3 washes with buffer containing 20 mM Tris, 150 mM NaCl, 2 mM EDTA, 1% Triton X–100, and 0.1% SDS, the pulldown was dissociated from the beads with elution buffer (50 mM Tris, 10 mM EDTA, 1% SDS) at 65°C and analyzed by Western blotting as described above.
Sun H., Damez–Werno D.M., Scobie K.N., Shao N., Dias C., Rabkin J., Koo J.W., Korb E., Bagot R.C., Ahn F.H., Cahill M.E., Labonté B., Mouzon E., Heller E.A., Cates H., Golden S.A., Gleason K., Russo S.J., Andrews S., Neve R., Kennedy P.J., Maze I., Dietz D.M., Allis C.D., Turecki G., Varga–Weisz P., Tamminga C., Shen L, & Nestler E.J. (2015). ACF chromatin remodeling complex mediates stress–induced depressive–like behavior. Nature medicine, 21(10), 1146-1153.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!