Lightcycler 480 dna sybr green 1 master reaction mix

At DIV9, neurons were infected by BoDV-1 at MOI = 0.03. 5 days post-infection, neurons were treated with ETP at 0.5 μM or with DMSO alone. 24, 48 or 72 hours after treatment, total RNA was extracted. Total RNA was prepared from cells using a Monarch® Total RNA Miniprep Kit (New England BioLabs) according to the manufacturer’s instructions. Total RNA was reverse transcribed using LunaScript™ RT SuperMix Kit (New England BioLabs). Quantitative PCR was performed on cDNAs using sets of primers specific for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for normalization (forward primer, 5’ TGCTGGTGCTGAGTATGTCG 3’; reverse primer, 5’ GGCGGAGATGATGACCCTTT 3’) or with primers specific for viral cDNA (forward primer, 5’ CCTTCTAACAAAATGAATACACGC 3’; reverse primer, 5’ CTGATATCCTTCTCATGCCC 3’). qPCRs mix were made using Light-Cycler 480 DNA SYBR green I Master reaction mix (Roche Diagnostics) and run in duplicates using a LightCycler 480 instrument (Roche Diagnostics). PCR cycles were as follows: after an initial incubation at 95°C for 5 min, 40 amplification cycles were run (at 95°C for 10 s, 60°C for 15 s, then 72°C for 15 s) followed by melting curve analysis. Viral genome quantification was expressed in arbitrary units according to the following threshold cycle (CT) formula: amount of viral RNA = 2⁻⁽Ct ^{BoDV −} Ct ^GAPDH).

Total RNA was isolated using Trizol® reagent and concentration and purity were determined by reading the absorbance at 260/280 nm in a UV spectrophotometer (BioPhotometer plus, Eppendorf). Genomic DNA was removed by DNAse I treatment (RQ1 Promega). 1 μg of total RNA was reverse transcribed to cDNA using M-MLV (Promega) and 25 μM Hexamers (Fermentas). Quantitative PCR was performed using the LightCycler 480 DNA SYBR Green I Master reaction mix (Roche Diagnostics) and the LightCycler® 480 System (Roche). In order to detect GHSR-1a expression specifically, forward 5′- TGCTGGCTGTAGTGGTGTTTGC-3′ and reverse 5′-AGGACAAAGGACACGAGGTTGC- 3′ primers were designed using the QuantPrime web application. TBP expression was used as the housekeeping gene. The data represent the results of RNA analyses from 3 different independent experiments. The data depicted represents the relative mRNA levels calculated with a 2−ΔΔCt method where ΔCt = Ct gene of interest−Ct TBP.

Total RNA from mouse liver was extracted using UPzol lysis reagent (biotechrabbit, Hennigsdorf, Germany). Complementary DNA was synthesized using Moloney murine leukemia virus reverse transcriptase (Promega). Quantitative polymerase chain reactions with Hamp and Hprt primers listed in Belot et al²¹ (link) were prepared with LightCycler 480 DNA SYBR Green I Master reaction mix (Roche Diagnostics) and run on a LightCycler 480 System (Roche Diagnostics). ΔCt values were obtained by subtracting the reference gene Ct to the target gene Ct.