Log In Sign up
The largest database of trusted experimental protocols

Ab9110 is a laboratory equipment product from Cell Signaling Technology. It is a primary antibody used for the detection of specific protein targets in various assays.

Automatically generated - may contain errors

Lab products found in correlation

Protein g magnetic beads, by Cell Signaling Technology (1 mentions) Ab109451, by Proteintech (1 mentions) Silverquest, by Thermo Fisher Scientific (1 mentions) Ab5095, by Abcam (1 mentions) Ab290, by Abcam (1 mentions) Bis tris polyacrylamide gel, by Thermo Fisher Scientific (1 mentions) Ab1791, by Abcam (1 mentions) Amersham hybond p0.2 pvdf, by GE Healthcare (1 mentions) Odyssey scanner, by LI COR (1 mentions) Ipvh00010, by Merck Group (1 mentions) Sa00001 1, by Proteintech (1 mentions) Rpb1 ntd, by Cell Signaling Technology (1 mentions)

5 protocols using ab9110

1

Telomeric ChIP with Shelterin Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Telomeric ChIP was performed as previously described (Loayza and De Lange, 2003 (link)). Telomeric DNA associated with shelterin proteins was immunoprecipitated with the following crude sera or purified antibodies: crude rabbit TRF1 (#371), crude rabbit TIN2 (#865), crude rabbit TPP1 (#1151), POT1 (Abcam, ab123784), anti-HA (Abcam, ab9110) and protein G magnetic beads (Cell signaling). For ChIP of exogenously introduced TIN2 alleles, 293T cells were transfected by calcium phosphate transfection, and crosslinked and harvested 36–48 hr after transfection.
Schmutz I., Mensenkamp A.R., Takai K.K., Haadsma M., Spruijt L., de Voer R.M., Choo S.S., Lorbeer F.K., van Grinsven E.J., Hockemeyer D., Jongmans M.C, & de Lange T. (2020). TINF2 is a haploinsufficient tumor suppressor that limits telomere length. eLife, 9, e61235.
+ Open protocol
+ Expand
2

Protein Interactions in Hepatocellular Carcinoma

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
These experiments were performed as described previously.
11 (link),
12 (link) For Co‐IP, HCC cell lines including MHCC‐97H, Huh7‐SMYD4, Huh7 pre‐transfected with plasmids of Flag‐labeled different PRMT5 regions, and HA‐labeled SMYD4 were used. The cell protein lysates were mixed with antibodies of PRMT5 (Abcam, ab109451), SMYD4 (Proteintech, 17594‐1‐AP), HA (Abcam, ab9110), or Flag (Cell Signaling Technology, #14793) according to each experiment. Silver staining was performed using a silver stain kit SilverQuest™ (ThermoFisher Scientific) according to the manufacturer's instructions. LS‐MS detection and analysis were performed by BGI Company.
Zhou Z., Chen Z., Zhou Q., Meng S., Shi J., Mui S., Jiang H., Lin J., He G., Li W., Zhang J., Wang J., He C., Yan Y, & Xiao Z. (2024). SMYD4 monomethylates PRMT5 and forms a positive feedback loop to promote hepatocellular carcinoma progression. Cancer Science, 115(5), 1587-1601.
+ Open protocol
+ Expand
3

Immunoblotting Analysis of Protein Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were separated on 4–12% Bis–Tris polyacrylamide gel (Invitrogen) followed by transfer to Amersham™ Hybond® P 0.2 PVDF (GE Healthcare) for immunoblotting. Primary antibodies: anti- anti-ELP1 (1:250, Abcam, ab56362), anti-ELP3 (1:1000, Abcam, ab96781), anti-AAG (1:1000, custom rabbit polyclonal antibody, Covance, raised against ∆80AAG) or anti-AAG (1:1000, LSBio LS-C133325), anti-RNA pol II S2P (1:1000, Abcam, ab5095), anti-HA (1:1000, Abcam, ab9110), anti-α-Tubulin (1:10000, Cell Signaling, 2144), anti-H3 (1:1000, Abcam, ab1791), anti-GFP (1:1000, Abcam, ab290); were detected using infrared (IR) Dye-conjugated secondary antibodies (1:15000, Li-COR Bioscienecs, 827-11081 and 925-32210). The signal was visualized by using direct IR fluorescence via the Odyssey Scanner, LI-COR Biosciences.
Montaldo N.P., Bordin D.L., Brambilla A., Rösinger M., Fordyce Martin S.L., Bjørås K.Ø., Bradamante S., Aas P.A., Furrer A., Olsen L.C., Kunath N., Otterlei M., Sætrom P., Bjørås M., Samson L.D, & van Loon B. (2019). Alkyladenine DNA glycosylase associates with transcription elongation to coordinate DNA repair with gene expression. Nature Communications, 10, 5460.
+ Open protocol
+ Expand
4

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein lysates were isolated in lysis buffer and followed by the addition of sample loading buffer (4Abio, 4APA008-15), separated by 10% SDS polyacrylamide gel electrophoresis (EpiZyme, PG11X) and transferred onto PVDF membranes (Merck Millipore, IPVH00010). The membranes incubated with primary antibodies against: NAT10 (Santa Cruz, [sc-271770] or Proteintech, [13365-1-AP], 1:2 000), RNPS1 (Proteintech, 10555-1-AP, 1:2 000), HA (Abcam, ab9110, 1:4 000) and GAPDH (Cell Signaling Technology, 2118S, 1:2 000). Enhanced chemiluminescence (ECL) method with appropriate species-specific horseradish peroxidase-conjugated secondary antibodies (Proteintech, anti-rabbit [SA00001-2] 1:4 000, anti-mouse [SA00001-1] 1:4 000) were used to visualize the blots.
Wang X., Ling R., Peng Y., Qiu W, & Chen D. (2024). RNPS1 stabilizes NAT10 protein to facilitate translation in cancer via tRNA ac4C modification. International Journal of Oral Science, 16, 6.
+ Open protocol
+ Expand
5

ChIP-qPCR Analysis of CDK7 and Rpb1 in H460 and H1975 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was performed on H460 cells transfected with a control YFP or CDK7 HA construct, or on H460 and H1975 cells 6 h after treatment with DMSO, Milciclib, THZ1, or LDC4297 (10 μM) using the SimpleChIP Plus ChIP kit (Cell Signaling) following the manufacturer’s protocol. The following antibodies were used: HA (Abcam; ab9110; 1:714 dilution), Rpb1 NTD (Cell Signaling; D8L4Y; 1:147 dilution), and phospho-Ser5 Rpb1 CTD (Cell Signaling; D9N5I; 1:50 dilution). qPCR was performed as previously described using the following primers:
GLUT1 (SLC2A1) forward primer: CCCTAGTGCACCGAAGTCAC
GLUT1 (SLC2A1) reverse primer: GTACCCGGCTGTAAGGCAAG
Ghezzi C., Wong A., Chen B.Y., Ribalet B., Damoiseaux R, & Clark P.M. (2019). A high-throughput screen identifies that CDK7 activates glucose consumption in lung cancer cells. Nature Communications, 10, 5444.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!