Cell lysates were incubated with with Pierce™ Protein A/G Magnetic Beads (Thermo Fisher Scientific) conjugated with a rabbit anti‐Ago2 (Abcam, ab32381) antibody or with a negative control normal rabbit anti‐IgG (Abcam, ab188776). The mixture was incubated at 4°C for 4 h and the magnetic beads were precipitated using a magnetic bar. Both the input and the samples on the beads were purified with Trizol reagent according to the manufacturer's protocol. The relative enrichment of miRNAs and circRNA was quantified by qRT‐PCR.
Ab188776
Manufactured by Abcam
Sourced in United Kingdom
Ab188776 is a recombinant antibody fragment. It is designed for use in research applications.
Automatically generated - may contain errors
Lab products found in correlation
Ab32381, by Abcam (1 mentions)
Pierce protein a g magnetic beads, by Thermo Fisher Scientific (1 mentions)
Ab57113, by Abcam (1 mentions)
Jem 1010 transmission electron microscope, by JEOL (1 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (1 mentions)
Ip lysis buffer, by Beyotime (1 mentions)
Trizol reagent, by Beyotime (1 mentions)
Ab1101, by Abcam (1 mentions)
Evagreen dye technology, by Bio-Rad (1 mentions)
Mouse beta actin antibody, by Proteintech (1 mentions)
Ab18672, by Abcam (1 mentions)
Ab10400, by Abcam (1 mentions)
Ab10401, by Abcam (1 mentions)
Biocoat matrigel invasion chamber, by Corning (1 mentions)
Diff quik, by Sysmex (1 mentions)
7 protocols using ab188776
1
Ago2-Mediated miRNA and circRNA Enrichment
2
Visualizing Ago2 Protein in RBCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RBCs, including 3%–4% iRBCs, were fixed in 4% paraformaldehyde and 1.25% glutaraldehyde, followed by four steps of dehydration. Dehydrated cells were imbedded in LR-White (London Resin Company Ltd, Hampshire, UK) and were cut into ultrathin sections. The sections were incubated in mouse anti-Ago2 monoclonal antibody (ab 57113, Abcam), and normal mouse IgG multiple antibody (ab 188776, Abcam) was set as a control (Supplementary Figure S4 ). The gold-conjugated anti-mouse IgG secondary antibody (Sigma-Aldrich) was then applied. The sections were stained with uranyl acetate and were examined under a JEM-1010 transmission electron microscope (TEM, JEOL, Japan).
3
Ago2-Mediated RNA Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IP lysis buffer (P0013, Beyotime, Beijing, China) was employed for cell lysis. Thereafter, Magna RIP RNA-Binding Protein Immunoprecipitation Kit (17-700, Millipore, CA, USA) was utilized to incubate cells in RIP assay. Then, the rabbit anti-Ago2 antibody (ab32381) or negative control normal rabbit anti-IgG (ab188776, Abcam, Cambridge, UK) was conjugated onto kits-derived protein A/G magnetic beads. Later, cell lysates were incubated using the resultant antibody-bead mixture overnight under 4°C. The magnetic bar was adopted for the precipitation of magnetic beads. Then, samples were washed by NT2 buffer twice. The eluted samples were purified with Trizol reagent (L28164, Beyotime, Beijing, China), and RT-qPCR analysis was adopted for quantifying the relative enrichment of each molecule.
4
ChIP-qPCR Analysis of p53 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four micrograms of DO‐1 anti‐p53 monoclonal antibody (#ab1101, Abcam) was used. Isotype‐matched pre‐immune mouse IgG (#ab188776, Abcam) was used as a negative control. Quantitative real‐time PCR with EvaGreen dye technology (Bio‐Rad) was used for the analysis of the DNA in ChIP samples. ChIP data analysis was performed using the fold enrichment method and normalizing to the mock (IgG) control for each sample. The oligonucleotides used for positive and negative controls were as previously described [59]. The p21 promoter (5′ p53 response element) was amplified with the primers forward, 5′‐CTGGACTGGGCACTCTTGTC‐3′ and reverse 5′‐CTCCTACCATCCCCTTCCTC‐3′. The negative control promoter was amplified with the primers forward, 5′‐GGAGTCCTGTTTGCTTCTGG‐3′ and reverse 5′‐CTTTGGCCACACTGAGGAAT‐3′ and was used as previously described.24
5
Anti-hPDPN Monoclonal Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SZ163 and SZ168, two mouse anti-hPDPN mAbs, were developed as described previously [24 (link)]. A mouse anti-hPDPN mAb (18H5), a normal mouse IgG (ab188776), and a rabbit anti-hPDPN mAb (EPR7072) were purchased from Abcam (Cambridge, UK). A mouse beta-actin antibody was purchased from ProteinTech (Wuhan, China). Fluorescein isothiocyanate-conjugated goat anti-mouse IgG polyclonal antibodies (FITC-GAM IgG) were purchased from Beckman-Coulter (Suzhou, China).
6
Transwell Migration and Invasion Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the migration assay, TE cells (5.0 × 105 cells/ well) in serum-free media were plated on the upper transwell inserts with an 8-μm pore filter (BD Falcon, Lincoln Park, NY) in 24-well plates. For the invasion assay, TE cells (5.0 × 105 cells/ well) in serum-free media were plated on the inserts of a Corning® BioCoat™ Matrigel® Invasion Chamber (Corning, Tewksbury, MA) in 24-well plates. Medium containing 1% FBS was added in the lower chamber. Recombinant human CXCL8, inhibitors, or neutralizing antibodies were added in the upper chamber and incubated at 37°C. After 24 h or 48 h, the cells were stained with Diff-Quik (Sysmex, Kobe, Japan), and then the cells on the upper surface of the membrane were removed with a cotton swab and air-dried. Five images at 100× magnification were obtained from each membrane with a CCD camera, and the number of cells was counted. The inhibitors against PI3K (LY294002) and MEK1/2 (PD98059) were purchased from Cell SignaIing Technology. The neutralizing antibodies were as follows (all from Abcam): normal mouse IgG (#ab188776); mouse antibody against CXCR1 (#ab10400); mouse antibody against CXCR2 (#ab10401); mouse antibody against CXCL8 (#ab18672).
7
Immunoprecipitation of GFP-tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell pellets were lysed with IP lysis buffer (20 mM Tris-HCl, pH 8.0, 137 mM NaCl, 1% NP40 and 2 mM EDTA supplemented with 1% protease inhibitor cocktail) on ice for 20 min. The lysate was centrifuged at 9,000 x g for 5 min at 4̊C and the supernatant was collected and transferred to pre-cooled fresh tubes. The protein concentration was equilibrated with the IP lysis buffer. Subsequently, 2 µl anti-GFP GF28R antibody (Thermo Fisher Scientific, Inc.) were added per 500 µg protein sample prior to being incubated overnight at 4˚C. Normal mouse IgG (1:1,000, ab188776, Abcam) was used as a negative control. The lysates were subsequently incubated with pre-washed protein G agarose beads (20 µl/500 µg protein) for 1 h at 4˚C with gentle agitation. The beads were washed 3 times with IP lysis buffer and then centrifuged at 1,600 x g for 3 min at 4̊C. Subsequently, the beads were heated for 5 min at 95˚C in 2X Laemmli sample buffer and target proteins were detected by western blot analysis using specific antibodies as described above. Two independent experimental repeats were performed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!