HEK293T cell line and Lenti-X Lentivirus packaging system (Clontech Laboratories, Inc) were used for generating lentivirus according to the manufacturer’s protocol. Medium which contains lentivirus were collected and add Lenti-X concentrator in 4 °C for additional 24 h. Lentivirus was obtained after spinning down and was resuspended in PBS. The lentivirus was stored in −80 °C. For each well, 0–8 μl of UCHL5 shRNA lentivirus was mixed with 1 μl of hexadimethrine bromide (10 mg/ml). Cells were analyzed 72 h after transduction.
Lenti x lentivirus packaging system
Manufactured by Takara Bio
The Lenti-X Lentivirus Packaging System is a lab equipment product that facilitates the production of lentiviral particles. It provides the essential components required for the generation of recombinant lentiviral particles, which can be used for various research applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using lenti x lentivirus packaging system
1
Generating Lentivirus for UCHL5 Knockdown
2
Lentiviral Knockdown of USP11
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
USP11 shRNA lentiviral vector plasmid encoding USP11-specific nucleotide shRNA (CCGGCCCTCCCTTCTAGTCTTTATTCTCGAGAATAAAGACTAGAAGGGAGGGTTTT) was obtained from Sigma-Aldrich. A HEK293T cell line and Lenti-X Lentivirus Packaging System (Clontech Laboratories, Inc.) were used to propagate the lentivirus used in the knockdown experiments. The manufacturer's protocol was followed. For each experiment using USP11 shRNA, 4 μl of lentivirus was mixed with 1 μl of hexadimethrine bromide (10 mg/ml) and added directly to the cells. Cells were then collected 72 h following inoculation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!