Anti p camkii

Manufactured by Abcam

Sourced in United States

Anti-p-CaMKII is a primary antibody that specifically recognizes the phosphorylated form of Calcium/Calmodulin-dependent Protein Kinase II (CaMKII). CaMKII is a key enzyme involved in the regulation of various cellular processes, and its activation is dependent on phosphorylation. This antibody can be used to detect and quantify the levels of phosphorylated CaMKII in biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Anti gapdh, by Santa Cruz Biotechnology (3 mentions) Stripping buffer, by Thermo Fisher Scientific (2 mentions) Image reader las 4000, by Fujifilm (2 mentions) Bis tris gel, by Bio-Rad (2 mentions) Anti psd95, by Merck Group (2 mentions) Peroxidase labeled anti rabbit igg, by Vector Laboratories (2 mentions) Anti p tau ps396, by Abcam (2 mentions) Anti total tau t46, by Thermo Fisher Scientific (2 mentions) Peroxidase labeled anti mouse igg, by Vector Laboratories (2 mentions) Peroxidase labeled anti rat igg, by Vector Laboratories (2 mentions) Anti p smad2, by Abcam (2 mentions) Anti smad2 3, by Cell Signaling Technology (2 mentions) Anti collagen 1, by Abcam (2 mentions) Anti tgf β, by R&D Systems (2 mentions) Anti tric b, by Thermo Fisher Scientific (2 mentions) Anti hsp47, by Santa Cruz Biotechnology (2 mentions) Anti psmad3 phospho s423 s425, by Rockland Immunochemicals (2 mentions) Anti β actin antibody, by Santa Cruz Biotechnology (2 mentions) Swift membrane stain, by G Biosciences (2 mentions) Rc dc protein assay, by Bio-Rad (2 mentions)

7 protocols using anti p camkii

Antibody Profiling for Cell Stress Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used in the study: anti-GRP78 (sc-1050, Santa Cruz, CA, USA), anti-p-PERK Thr981 (sc-32577, Santa Cruz), anti-eIf2α (sc-133132, Santa Cruz), anti-CRT (sc-166837, Santa Cruz), anti-ERp57 (sc-28823, Santa Cruz), anti-Ub (sc-8017, Santa Cruz), anti-p-Akt1/2/3 (sc-7985, Santa Cruz), anti-GAPDH (sc-32233, Santa Cruz), anti-GFP (sc-8334, Santa Cruz), anti-Lamin B1 (sc-374015, Santa Cruz), anti-CaM (sc-137079, Santa Cruz), anti-CaMKIIγ (sc-1541, Santa Cruz), CREB-1 (sc-186, Santa Cruz), anti-p-CaMKII (ab182647, abcam, Waltham, MA, USA), anti-Bcl-2 (610539, BD Biosciences, Franklin Lakes, NJ, USA), anti-cleaved-caspase 3 (9664, Cell Signaling Technology, Danvers, MA, USA), anti-p-CREB Ser133 (9198, Cell Signaling Technology), anti-p-eIF2α Ser51 (9721, Cell Signaling Technology), and anti-PARP (9542, Cell Signaling Technology). All secondary antibodies (HRP-conjugated anti-rabbit, anti-mouse, and anti-goat) were purchased from Sigma (Sigma-Aldrich Inc., St. Louis, MO, USA). All the drug formulations were purchased from Sigma (Sigma-Aldrich Inc.).

Liu Y.S., Chang Y.C., Kuo W.W., Chen M.C., Wang T.F., Chen T.S., Lin Y.M., Li C.C., Liao P.H, & Huang C.Y. (2022). Calreticulin nuclear translocalization alleviates CaM/CaMKII/CREB signaling pathway to enhance chemosensitivity in HDAC inhibitor-resistant hepatocellular carcinoma cells. Aging (Albany NY), 14(12), 5097-5115.

+ Open protocol

+ Expand

Western Blot Analysis of VSMC Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

After Ang II and CIH treatment, the whole proteins in primary VSMCs were isolated by lysing cells with radioimmunoprecipitation assay (Beyotime, Shanghai, China). A equal amount of protein extracts was subjected to 12% SDS-PAGE and transferred onto nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The following primary antibodies were used to probe targeted proteins: anti-MMP9 (final volume 1 : 500 v/v, GeneTex), anti-MCP1 (1 : 1000 v/v, GeneTex), anti-GAPDH (1 : 5000 v/v, GeneTex), anti-Bax (1 : 500 v/v, GeneTex), anti-Bcl-2 (1 : 500 v/v, GeneTex), anti-caspase-3 (cleaved Asp175, 1 : 500 v/v, GeneTex), anti-p38 (1 : 500 v/v, GeneTex), anti-MMP2 (1 : 500 v/v, Abcam), anti-p-CaMKII (phospho T286, 1 : 1000 v/v, Abcam, Cambridge, MA), anti-CaMKII (1 : 1000 v/v, Abcam), anti-p-p38 (phospho T180, 1 : 1000 v/v, Abcam), anti-Jnk1/2/3 (phospho T183+T183+T221, 1 : 1000 v/v, Abcam), and anti-Jnk1/2/3 (1 : 1000 v/v, Abcam). After incubation with secondary antibodies (1 : 2000 v/v, Abcam) at room temperature for 1 h, the band was semiquantified by Image-Pro Plus software (Media Cybernetics, Silver Spring, USA).

Xu C., Xu J., Zou C., Li Q., Mao S., Shi Y., Tan Y., Gu W, & Ye L. (2021). Chronic Intermittent Hypoxia Regulates CaMKII-Dependent MAPK Signaling to Promote the Initiation of Abdominal Aortic Aneurysm. Oxidative Medicine and Cellular Longevity, 2021, 2502324.

+ Open protocol

+ Expand

Quantitative Protein Analysis in Tau Pathology

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal amounts of protein (30 μg) were separated by electrophoresis in precast 4-12% Bis-Tris Gels (Bio-Rad) and transferred to activated/pre-wetted PVDF membranes. The membranes were hybridized with the following primary antibodies as indicated: AT8 anti-P-tau pSer202/Thr205 (1:500, Thermo Scientific, #MN1020); anti-P-tau pS396 (1:1000, Abcam, #ab109390); anti-total tau T46 (1:1000, Thermo Scientific, #13-6400); anti-GAPDH (1:2000, Santa Cruz, #sc-32233); anti=P-CaMKII (1:1000, Abcam, #ab32678); anti-PSD-95 (1:1000, Millipore, #7E3-1B8), C1q (1:1000, Abcam, #ab182451). Secondary antibodies included: peroxidase labeled anti-mouse IgG (1:2000, Vector Laboratories); peroxidase labeled anti-rabbit IgG (1:2000, Vector Laboratories); peroxidase labeled anti-rat IgG (1/2000, Vector Laboratories). ECL (Pierce®) was used to reveal the immunoreactive proteins, and images were acquired using a Fujifilm ImageReader LAS-4000. Membranes were stripped using a stripping buffer (Thermo Scientific) when required. Luminescent immunoreactive protein bands were quantified using Fiji software (ImageJ).

Audrain M., Haure-Mirande J.V., Wang M., Kim S.H., Fanutza T., Chakrabarty P., Fraser P., St George-Hyslop P.H., Golde T.E., Blitzer R.D., Schadt E.E., Zhang B., Ehrlich M.E, & Gandy S. (2018). Integrative approach to sporadic Alzheimer’s disease: deficiency of TYROBP in a tauopathy mouse model reduces C1q and normalizes clinical phenotype while increasing spread and state of phosphorylation of tau. Molecular Psychiatry, 24(9), 1383-1397.

+ Open protocol

+ Expand

Antibody and Primer Reagents for Flow Cytometry

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies for flow cytometry, anti-Kit-APC, anti-Mac-1-APC, anti-Gr-1-PE, anti-CD3-APC, and anti-B220-PE, were purchased from BioLegend and used as described [1 (link)]. The manufacturers and catalog numbers for other antibodies and reagents are as follows: anti-PirB-PE, R&D Systems, FAB2754P; pCAMKI, Santa Cruz, sc-28438; anti-pCAMKII, Abcam, ab32678; anti-pCAMKIV, Santa Cruz Biotechnology, sc-28443-R; anti-CAMKI, Abcam, ab68234; anti-CAMKII, Cell Signaling, 4436; anti-CAMKIV, Cell Signaling, 4032; anti-pCREB, Cell Signaling, 9198S; anti-CREB, Cell Signaling, 9197S; anti-actin, Sigma Aldrich, A2066; STO-609, Sigma Aldrich, S1318; KN93, Sigma Aldrich, K1385; The PCR primer sequences were as follows: hCAMKI forward: CGGAGGACA TTAGAGACA, reverse: CTCGTCATAGAAGGGAGG-3; hCAMKIV forward: GATGAAAGAGGCGATCAG, reverse: TAGGCCCTCCTCTAGTTC. PirB forward: GAG AATCACCAGACACATGC, PirB reverse: CTGCCCTCATGTCTTAACTT, mCAMKIV forward: AAGCAGGCGGAAGACATTAGG, CAMKIV reverse: AGTTTCTGAGTCCTCTTGTCCT.

Kang X., Cui C., Wang C., Wu G., Chen H., Lu Z., Chen X., Wang L., Huang J., Geng H., Zhao M., Chen Z., Müschen M., Wang H.Y, & Zhang C.C. (2018). CAMKs support development of acute myeloid leukemia. Journal of Hematology & Oncology, 11, 30.

+ Open protocol

+ Expand

Western Blot Analysis of Tau and Synaptic Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal amounts of protein (30 μg) were separated by electrophoresis in precast 4–12% Bis-Tris Gels (Bio-Rad) and transferred to activated/pre-wetted polyvinylidene difluoride membranes. The membranes were hybridized with the following primary antibodies as indicated: AT8 anti-P-tau pSer202/Thr205 (1:500, Thermo Scientific, #MN1020); anti-P-tau pS396 (1:1000, Abcam, #ab109390); anti-total tau T46 (1:1000, Thermo Scientific, #13-6400); anti-GAPDH (1:2000, Santa Cruz, #sc-32233); anti-P-CaMKII (1:1000, Abcam, #ab32678); anti-PSD-95 (1:1000, Millipore, #7E3-1B8), C1q (1:1000, Abcam, #ab182451). Secondary antibodies included: peroxidase-labeled anti-mouse IgG (1:2000, Vector Laboratories); peroxidase-labeled anti-rabbit IgG (1:2000, Vector Laboratories); peroxidase-labeled anti-rat IgG (1:2000, Vector Laboratories). ECL (Pierce®) was used to reveal the immunoreactive proteins, and images were acquired using a Fujifilm ImageReader LAS-4000. Membranes were stripped using a stripping buffer (Thermo Scientific) when required. Luminescent immunoreactive protein bands were quantified using Fiji software (ImageJ).

+ Open protocol

+ Expand

Quantitative Western Blot Analysis of Bone Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein lysates were obtained from minced bones and from OBs using RIPA lysis buffer supplemented with protease inhibitors as previously described(47 (link)). Following protein quantitation using RC DC Protein Assay (BioRad), proteins were separated on 6% (collagen), 9% (pSMAD2 and SMAD2/3), 10% (TRIC-B, HSP47) or 15% (TGF-β) SDS-PAGE and transferred on PVDF membrane. The membranes were incubated o/n at 4°C with 1:1000 anti-TRIC-B (Invitrogen), anti-SMAD2/3 (Cell Signaling), anti-pSMAD2 (Abcam), anti-pSMAD3 (Abcam), anti-HSP47 (Santa Cruz) anti-collagen I (Abcam), anti-TGF-b (R&D System), anti-pCaMKII (Abcam) antibodies in TBS-T. ImageQuant LAS 4000 (GE Healthcare) and the ImageQuant LAS 4000 1.2 software were used for images acquisition. ImageQuant TL analysis software was employed for band intensity evaluation. At least biological triplicates were performed. For each gel, the expression of the mutant samples was expressed as fold difference compared to controls. Protein loading normalization was determined using anti-β-actin antibody (Santa Cruz Biotechnology) or total proteins staining by Swift^™ Membrane Stain (G-Biosciences). For human cells, the following antibodies and dilutions were used: anti-pSMAD3 (phospho S423/S425) 1:1000 (Rockland) and anti-GAPDH 1 :1000 (Cell Signaling).

Joiner W.J., Wang L.Y., Tang M.D, & Kaczmarek L.K. (1997). hSK4, a member of a novel subfamily of calcium-activated potassium channels. Proceedings of the National Academy of Sciences of the United States of America, 94(20), 11013-11018.

+ Open protocol

+ Expand

Protein Expression Analysis in Osteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein lysates were obtained from minced bones and from OBs using RIPA lysis buffer supplemented with protease inhibitors as previously described (47) . Following protein quantitation using RC DC Protein Assay (BioRad), proteins were separated on 6% (collagen), 9% (pSMAD2 and SMAD2/3), 10% (TRIC-B, HSP47) or 15% (TGF-β) SDS-PAGE and transferred on PVDF membrane. The membranes were incubated o/n at 4°C with 1:1000 anti-TRIC-B (Invitrogen), anti-SMAD2/3 (Cell Signaling), anti-pSMAD2 (Abcam), anti-pSMAD3 (Abcam), anti-HSP47 (Santa Cruz) anti-collagen I (Abcam), anti-TGF-b (R&D System), anti-pCaMKII (Abcam) antibodies in TBS-T. ImageQuant LAS 4000 (GE Healthcare) and the ImageQuant LAS 4000 1.2 software were used for images acquisition. ImageQuant TL analysis software was employed for band intensity evaluation. At least biological triplicates were performed. For each gel, the expression of the mutant samples was expressed as fold difference compared to controls. Protein loading normalization was determined using anti-β-actin antibody (Santa Cruz Biotechnology) or total proteins staining by Swift ™ Membrane Stain (G-Biosciences). For human cells, the following antibodies and dilutions were used: anti-pSMAD3 (phospho S423/S425) 1:1000 (Rockland) and anti-GAPDH 1 :1000 (Cell Signaling).

Besio R., Contento B.M., Garibaldi N., Filibian M., Sonntag S., Shmerling D., Tonelli F., Biggiogera M., Brini M., Salmaso A., Jovanovic M., Marini J.C., Rossi A, & Forlino A. (2023). CaMKII inhibition due to TRIC-B loss-of-function dysregulates SMAD signaling in osteogenesis imperfecta. Matrix biology : journal of the International Society for Matrix Biology, 120.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!