Aurum rna isolation kit

RNA was extracted using the Aurum RNA isolation kit (Bio-Rad Laboratories, Hercules, CA) following the manufacturer’s instructions. cDNA was synthesized using the Bio-Rad iScript kit. 0.5 μg of total RNA was used in each 20 μl reverse transcription reaction, and the resulting cDNA was diluted 1:10 with water for qPCR analysis. qPCR was performed using the Bio-Rad SYBR green supermix with 0.2 μM of each forward and reverse primer and 2.5 or 1.25 μl of diluted cDNA in a total reaction volume of 6.5 or 3.25 μl. PCR amplification was carried out using the Bio-Rad iQ4 or the CFX384 qPCR system. All primers used in the study were tested to have a PCR efficiency between 100+/−10% and span intron/exon boundaries if possible. Gene expression levels were first normalized to an internal control gene, 36B4, and then to control conditions unless otherwise indicated. qPCR primers are listed in Supplementary Data 6. Each experiment was performed with at least three technical replicates. Data shown are representative of three independent experiments.

Total RNA was isolated with the Bio-Rad Aurum RNA isolation kit (Bio-Rad, Hercules, CA, USA) according to manufacturer instructions. cDNA was synthesized by the Mint reverse transcriptase kit (Evrogen, Moscow, Russia). After that, qPCR was performed with ready to use SYBR Green HS mix (Evrogen) and primers specific to the ACCN2, ACCN1, ACCN3, ACCN4, SCNN1A, and SCNN1G genes (Table 1) using the Roche LightCycler 96 amplifier (Roche, Basel, Switzerland).
Data were analyzed by the ∆∆Ct method and LightCycler SW software (Roche), and the gene expression was normalized to the expression of β-ACTIN, GPDH, and RPL13a housekeeping genes.

Fresh or flash-frozen muscle was directly added to 1 ml of Trizol reagent (15596026, Thermo Fisher Scientific) containing zirconia/silica beads (11079125z, BioSpec Products). The samples were homogenized for 1 min using a BioSpec bead beater. After homogenization, samples were spun at 12,000 g for 5 min at 4°C. Then 900 µl of supernatant was transferred to 1.5 ml tubes, 200 μl of chloroform was added to the samples, shaken and incubated for 5 min at room temperature. Samples were then spun at 12,000 g for 15 min at 4°C. The supernatant was then transferred to a fresh 1.5 ml tube and further processed using the Aurum RNA Isolation Kit (7326820, Bio-Rad Laboratories). Finally, 1 µg of RNA was reverse-transcribed to cDNA using the qScript reagent (95048, Quantabio).

Total RNA was isolated using the Bio-Rad Aurum RNA isolation kit (Bio-Rad) according to the manufacturer’s instructions. cDNA was synthesized by the Mint reverse transcriptase kit (Evrogen). After that, qPCR was performed with the ready-to-use SYBR Green HS mix (Evrogen) and primers specific to the ACCN2 (coding the ASIC1a isoform, PubMed Gene ID NM_020039.4), ACCN1, ACCN3, ACCN4, SCNN1A, and SCNN1G genes (Table S2) using the Roche LightCycler 96 amplifier (Roche, Basel Switzerland). Data were analyzed by the ΔΔCt method and LightCycler SW software (Roche), and the gene expression was normalized to the expression of β-ACTIN, GPDH, and RPL13a housekeeping genes.

Cells were pelleted (400 × g, 4 min), washed with PBS buffer and lysed in a cell lysis buffer (Aurum RNA Isolation Kit, Bio-Rad, USA). Cell lysate was processed according to the manufacturer’s protocol, including an in-column DNase treatment. The purified RNA was quantified and tested for the presence of contaminants with a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Reverse transcription of 700 ng of each purified RNA sample was performed using the M-MulV Taq RT-PCR Kit (New England Biolabs, USA). For individual RT-qPCR reaction mixtures, 2 µL of cDNA from the reverse transcription protocol were used. Individual reactions were run in triplicate using a CFX96 Real-Time PCR System (Bio-Rad, USA) in final volumes of 25 µL. Specific primers and the SsoFast™ EvaGreen Supermix (Bio-Rad, USA) were used for amplification and fluorescent detection of PCR products, respectively. The relative quantities of cDNA from treated and control cells were calculated by the Livak and Schmittgen 2^-∆∆Ct method [45 (link)]. P0 was used as a reference gene. Following primers were used for specific gene amplification: GLUT1-Forward TCGT CGTC GGCA TCCT CATC, GLUT1-Reverse CGGTTGATGAGCAGGAAGCG; P0-Forward TCGA CAAT GGCA GCAT CTAC, P0-Reverse ATCC GTCT CCAC AGAC AAGG.