The largest database of trusted experimental protocols
Sourced in United States

HFL-1 cells are a cell line derived from human fetal lung tissue. The cells are adherent and have a fibroblast-like morphology. This cell line is commonly used in research applications requiring a human lung cell model.

Automatically generated - may contain errors

2 protocols using hfl 1 cells

1

Lung Cell Transfection with OGG1 and p53

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 cells (CRM-CCL-185), which have some characteristic lung epithelial cells, and HFL-1 cells (CCL-153) were obtained from ATCC (Manassas, USA). BEAS-2B cells (GNHu27) were purchased from the Cell Bank of Type Culture Collection (Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China). Cells were cultured in DMEM or RPMI 1640 containing 10% fetal bovine serum (Gibco/BRL, Grand Island, USA) and cultured in a 37°C humidified incubator under 5% CO
2. Negative control siRNA (NC), OGG1 siRNA, p53 siRNA, PCMV-C-FLAG vector (Vector-NC), OGG1 overexpression vector (PCMV-OGG1-FLAG) or OGG1 mutants were transfected into lung cells using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, USA) in accordance with the manufacturer’s standard protocol. The sequence information is shown in
Table 3.

Table 3 Sequence information of negative control siRNA (NC), OGG1 siRNA and p53 siRNA

siRNA

Sense (5′→3′)

Antisense (5′→3′)

NC siRNA

UUCUCCGAACGUGUCACG

ACGUGACACGUUCGGAGAATT

OGG1 siRNA

GCGCAAGUACUUCCAGCUATT

UAGCUGGAAGUACUUGCGCTT

p53 siRNA-1

CUACUUCCUGAAAACAACGTT

CGUUGUUUUUCAGGAAGUAGTT

p53 siRNA-2

GCGCACAGAGGAAGAGAAUTT

AUUCUCUUCCUCUGUGCGCCG

+ Open protocol
+ Expand
2

TGF-β and Cigarette Smoke Exposure in HFL-1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HFL-1 cells were purchased from ATCC, and cultured in DMEM: F12K medium (11320033; Thermo Fisher Scientific) with 10% FBS (10082147; Thermo Fisher Scientific), 1% Penicillin-Streptomycin-Glutamine (10378016; Thermo Fisher Scientific), and 1% Non-Essential Amino Acids (11140076, Thermo Fisher Scientific). Before treatment, cells were serum deprived for 12 hours and then treated with 5 ng/mL TGF-β with or without 10 μM GSK4112 (3663; TOCRIS) for 3 days; or 0.1% CSE with or without 10 μM GSK4112 or 0.25% CSE for 2 days. CSE stock was always prepared freshly right before the treatment as described previously (13 (link)). In brief, CS (3R4F, University of Kentucky) was bubbling into 10 mL FBS-free DMEM: F12K medium (Phenol-red free) as 10% CSE stock. The 0.25% and 0.1% CSE working solutions were diluted from the stock CSE. Quality control of the CSE was based on the absorbance at 320 nm (1.00 ± 0.05 nm).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!