Vahts library quantification kit

Genomic DNA samples from formalin-fixed paraffin-embedded (FFPE) were extracted by using the QIAampDNA FFPE Tissue Kit according to the manufacturer’s instructions. The FFPE tissue section was cut into 5 μm in thickness and the percentage of tumor cells was more than 20%. Qubit dsDNA HS Assay Kit detected the concentration of DNA (>300ng and 10 ng/μL). The range of DNA input was from 50 to 200ng. If DNA input was <50ng, an extra PCR cycle was adopted during target enrichment. And then enzyme-shearing extracted DNA and sequencing libraries were prepared by using the TIANSeq DirectFast DNA Library Prep Kit. VAHTS Library Quantification Kit for Illumina was used to quantify nucleic acid when the Ct value of library was lower than 10.

Frozen CTLs were thawed, and RNA was isolated using an RNAqueous™-Micro Total RNA Isolation Kit (Life Technologies, USA). A total of 500 ng RNA of each sample was reverse transcribed into complementary DNA (cDNA) with a universal constant region primer for TCRβ (ATCTCTGCTTCTGATGGCTCA) using a qScript Flex cDNA Kit (Quantabio, USA). Multiplex PCR was then conducted to amplify the entire CDR3 region using a Multiplex PCR Assay Kit (TaKaRa, Japan) with forward primers specific to V segments and a reverse primer targeting the C region.^{23 (link)} PCR products were loaded onto a 2.5% agarose gel (Sigma, USA). After 90 min of electrophoresis at 130 V, bands centered at 300 bp were extracted (TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0). Real-time fluorescence quantitative PCR was used to quantify the absolute concentration of the purified fragment (VAHTS Library Quantification Kit for Illumina). Based on their concentrations, all libraries were pooled and subjected to sequencing using the HiSeq X Ten platform under a 150 bp paired-end strategy. About 1.5 GB data were generated for each sample, which contains about five millions of reads to ensure enough depth.