RNA was extracted from cells 48 hours post transfection with RNAeasy kit (Qiagen, Valencia, CA) and RNA (5µg) was treated with RNase-free DNaseI (Ambion). First-strand cDNA was synthesized from 820 ng of RNA using Roche First Strand cDNA Synthesis kit (Roche Applied Science). For real-time PCR experiments, 41 ng of RNA (start) was amplified in 2×SYBR PCR master mix using TF-Stepone RT PCR System (PE applied Biosystems, Branchburg, NJ) with the following primers (shown in 5’ to 3’ direction): for Actin, CCTTCCTGGGCATGGAGT and CAGGGCAGTGATCTCCTTCT; for LOX, TCAGATTTCTTACCCAGCCGA and GGCAGTCTATGTCTGCACCA; for MAP2K5, TACTCTTCAGGGATGTGCTG and CTTCAGGCCATGTATGTTCC; for VEGF, CCTTGCTGCTCTACCTCCAC and AGCTGCGCTGATAGACATCC; for PGK1, TTAAAGGGAAGCGGGTCGTTA and TCCATTGTCCAAGCAGAATTTGA. Samples were incubated at 95°C for 10 minutes, followed by 40 cycles, each consisting of 95°C for 15 seconds and 60°C for 1 minute. Melting curves were generated after each run to confirm amplification of specific transcripts. All quantifications were normalized to human β-actin. Real time PCR reactions were performed in triplicate.
First strand cdna synthesis kit
Manufactured by Roche
Sourced in Germany, Switzerland, United States, France, Australia, Spain, United Kingdom
The First Strand cDNA Synthesis Kit is a laboratory product that facilitates the conversion of RNA into complementary DNA (cDNA). This kit provides the necessary reagents and protocols to perform this reverse transcription process, which is a fundamental step in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (64 mentions)
Rneasy mini kit, by Qiagen (34 mentions)
Rneasy plus mini kit, by Qiagen (18 mentions)
Trizol, by Thermo Fisher Scientific (17 mentions)
Lightcycler 480, by Roche (16 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (8 mentions)
Sybr green, by Roche (7 mentions)
Rneasy micro kit, by Qiagen (7 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (7 mentions)
Rnaeasy kit, by Qiagen (6 mentions)
Sybr green mix, by Toyobo (6 mentions)
Tripure isolation reagent, by Roche (6 mentions)
Lightcycler 480 system, by Roche (6 mentions)
Sybr green kit, by Roche (6 mentions)
Lightcycler 480 sybr green 1 master, by Roche (6 mentions)
Rneasy kit, by Qiagen (6 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (6 mentions)
Nanodrop one, by Thermo Fisher Scientific (6 mentions)
Lightcycler 480 2, by Roche (6 mentions)
Nucleospin rna kit, by Macherey-Nagel (5 mentions)
303 protocols using first strand cdna synthesis kit
1
Quantitative Real-Time PCR Analysis of Gene Expression
2
Differential ICA1 Splicing in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Leaf tissue from 4 week-old plants grown at 23°C and 27°C under SD was collected and RNA was isolated with Trizol (Invitrogen). RNA was reverse transcribed using the Roche first strand cDNA synthesis kit (Roche). For ICA1 expression, RNA was isolated from three week-old plants grown at 23°C and 27°C under long days analyzed by quantitative PCR using primers described in S12 Table . To analyze alternative splicing, cDNAs were amplified from Col-0, Petro-1 and Dobra-1 grown at 23°C or 27°C using full length ICA1 coding region primers described in S12 Table , and cloned in to pGEM-T vector (Promega). Clones were sequenced with pUC/M13F and pUC/M13R primers (Macrogen, South Korea). After quality control, sequences were obtained for 48–96 clones as shown in S11 Table (76 and 96 colonies from Col-0 23°C and 27°C respectively; 48 colonies from Dobra-1 and 18 colonies from Petro-1 in 27°C short day). Sequences were aligned with Seqman (DNAStar Lasergene) to identify alternative splicing at 23°C and 27°C.
3
Retinal RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from a single retina was isolated using an RNeasy mini kit (Qiagen, Doncaster, VIC, Australia). Then, DNase treatment using TURBO DNA-free TM kit (Ambion, CA, USA) and reverse transcription (First Strand cDNA synthesis kit, Roche, Switzerland) were performed on 500 ng of RNA. 18s rRNA was used as an endogenous control to normalize mRNA expression. To quantify the mRNA expression, relative fold difference in expression was quantitated using the comparative 2-∆∆Ct method. The primer sequences for mouse 18s rRNA are forward primer: 5′-TCGAGGCCCTGTAATTGGAA-3′ and the reverse primer: 5′24 CCCTCCAATGGATCCTCGTT-3′. The primer sequences for VEGFA are forward primer: 5′-AGCAGAAGTCCCATGAAGTGATC-3′ and the reverse primer: 5′TCAATCGGACGGCAGTA-3′. The primer sequence for rat intercellular adhesion molecule-1 (ICAM-1) are forward primer: 5′-’TGAAGATGACGAGACGCAGAGT-3′ and the reverse primer: 5′-CCCAATGTGGCCAAATCC-3′ and rat IL-1ß are: forward: 5′-TCTCCAGTCAGGCTTCCTGT-3′ and the reverse primer: 5′AGGTCATTCTCCTCACTGTCGAAA-3′. Data are presented as the relative fold difference in expression calculated via the 2-ΔΔCT calculation. Five to eight mice/rats per group were evaluated.
4
Total RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNeasy Kits (Qiagen, Hilden, DE). The amount of total extracted RNA was estimated by measuring the absorbance at 260 nm and the purity by 260/280 and 260/230 nm ratios by Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA). For each sample, 1000 ng of total RNA was retrotranscribed using the First Strand cDNA Synthesis Kit (Roche, Basilea, CH).
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For comparative analysis of selected genes, we synthesized cDNA with the First Strand cDNA Synthesis Kit as described by the supplier (Roche, Rotkreuz, Risch, Switzerland). The obtained cDNA was subjected to PCR amplification with a real-time thermal cycler (Corbett Research; Fisher Scientific, Schwerte, Germany). FAM-labeled TaqMan gene expression probes and primers sets (all from Applied Biosystems, Foster City, CA) were used according to the conditions suggested by the suppliers. For normalization of expression, we used VIC-labeled GAPDH and 18S TaqMan probes and primers sets in the same reaction vial (GAPDH 4310884E, 18S 4319413E; Applied Biosystems). Quantification of mRNA expression within the samples was examined using the comparative Ct method (22) (link).
6
Neuroendocrine Differentiation Gene Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell lines using a Nucleospin RNA isolation kit (Macherey Nagl, Germany) according to manufacturer’s instructions. The RNA quality was checked by spectrophotometric absorbance measurements (260/280 ratio). Subsequently, pure RNA was converted into cDNA by reversed transcription using a first strand cDNA synthesis kit according to manufacturer’s instructions (Roche, Mannheim, Germany). Pre-validated and quality controlled TaqMan® probes (CHGA: Hs00900370_m1, DAXX: Hs00985566_g1, ISL1: HS00158126_m1, NEUROD1: HS01922995_s1, NEUROG3: HS01875204_s1, PDX: HS00236830_m1, SSTR1: HS00265617_s1, SSTR2: HS00265624_s1, SSTR3: HS00265633_s1, SSTR5: HS00990407, Thermo Fisher Scientific, Massachusetts, USA) were used to assess gene expression signatures of neuroendocrine differentiation. Samples were analyzed as duplicates in a Step One Plus Real-Time PCR System (Applied Biosystems, Foster City, USA). Using comparative Ct-analyses, gene expression values were normalized to that of the housekeeping gene GAPDH and were expressed as fold changes.
7
RNA Extraction and qPCR Analysis of Mammary Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mammary tissues and HMEpCs was extracted by Trizol Reagent (Ambion, Thermo Fisher Scientific) and quantified using NanoDrop ND-2000 (NanoDrop Technologies, Wilmington, DE, USA). RNA was reverse transcribed into cDNA using First-Strand cDNA Synthesis Kit (Roche Diagnostics, Mannheim, Germany). RT-PCR was performed using StepOnePlus Real-time PCR (Applied Biosystems-Life Technologies) with 10 μl reaction volume with mouse GAPDH or human18srRNA as the internal reference. Prevalidated Taqman Gene expression primers for V-ATPase ‘a' subunit isoforms ATP6V0a1, ATP6V0a2, ATP6V0a3 and ATP6V0a4; Notch pathway genes Notch 1, Hey1; TGF-β1, pSmad2, mammary proliferation markers Areg, Cited 1, lactation marker β-casein and internal control GAPDH and 18srRNA were all purchased from Applied Biosystems. Universal Fast PCR Master Mix Reagent (Applied Biosystems, Thermo Fisher Scientific) was used for qPCR amplification of the cDNA. Relative gene expression was calculated using the ΔCt method. Fold change was calculated using the ΔΔCt method.
8
Gene Expression Analysis of Hemangioblastoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from hemangioblastoma cells using a Nucleo Spin RNA kit (Macherey-Nagel, Düren, Germany). One microgram of total RNA was reverse-transcribed in a final volume of 20 μl with the First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) using random primers. SYBR Green PCR system (BioRad, Hercules, CA, USA) was used to carry out real-time PCR with an iQ5 system. The sequences of the oligonucleotides used corresponded to HIF-1α and -2α target genes, as follows: VEGF forward: 5’-ATCTGAGCAGGGCGACAGC-3’ and reverse 5’-ACTCCCTGTGGTGCAGTCA-3’; EPO forward 5’-TGTTTTCGCACCTACCATCA-3’ and reverse 5’-AAGTCACAGCTTGCCACCT-3’; and SOX2 forward 5’-GGGGGAATGGACCTTGTATAG-3’ and reverse 5’-CGCTCCACCAACTAAGAACG-3’. As an internal control, mRNA levels of 18S were measured using the following primers: forward 5’-CTCAACACGGGAAACCTCAC-3’ and reverse 5’-CGCTCCACCAACTAAGAACG-3’. Amplicons were detected using an iQ5 system (BioRad). The samples were used in triplicate and the experiment was repeated twice.
9
Quantifying Gene Expression in Colorectal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total rebonucleic acid (RNA) was extracted from tumor, polyp and normal colorectal biopsy samples using Trizol reagent (Roche Applied Science, Indianapolis, IN, USA) and reverse transcribed to obtain complementary DNA (cDNA) with First Strand cDNA synthesis kit (Roche Applied Science, Indianapolis, IN, USA), respectively, in accordance with the manufacturer’s instructions. PCR primers and Taqman hydrolysis probes for MMP-7, COX-2, TIMP-1 and β-actin genes were obtained from Roche Applied Science (Roche Applied Science, Indianapolis, IN, USA). β-actin was used as a housekeeping gene. Real Time PCR was performed using Light Cycler 480 Probes Master kit (Roche Applied Science, Indianapolis, IN, USA), which is a ready-to-use reaction mix that contains FastStart Taq DNA Polymerase, under the following conditions: an initial denaturation for 10 minutes at 95°C, 40 cycles of denaturation for 10 seconds at 95°C, annealing for 30 seconds at 60°C and elongation for 10 seconds at 72°C. LightCycler 480 (V1.5.0) Software (Roche Applied Science, Indianapolis, IN, USA) was used to measure the CT values and relative mRNA expression levels were calculated with comparative 2-AACT method.
10
Quantitative Analysis of WAPL Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from stems, buds, roots, leaves and siliques of wild-type plants to examine WAPL expression patterns, and from inflorescences of wild-type, Atwapl1-1wapl2 and Atwapl1-2wapl2 plants to measure WAPL transcript levels in mutant plants. Total RNA was extracted from with the Plant RNeasy Mini kit (Qiagen, Hilden, Germany), treated with Turbo DNase I (Ambion) and used for cDNA synthesis with an oligo (dt) primer and a First Strand cDNA Synthesis Kit (Roche). Real time PCR was performed with SYBR-Green PCR Mastermix (Clontech) and the amplification was monitored on a CFXsystems (Biorad). Expression was normalized against β-Tubulin-2. At least three biological replicates were performed, with two technical replicates for each sample. Primers used in this study are presented in (Table S1 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!