Power sybr green rna to ct 1 step kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Italy, Germany, France

The Power SYBR Green RNA-to-CT 1-Step Kit is a reagent system designed for one-step reverse transcription and real-time PCR amplification of RNA targets. The kit includes a SYBR Green-based master mix, reverse transcriptase, and other necessary components to facilitate the complete workflow from RNA to quantitative PCR results.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green (3216 citations) SYBR Green I (788 citations) Power SYBR Green (542 citations) SYBR Green kit (254 citations) Power SYBR Green RNA-to-CTTM 1-Step kit (16 citations) Power SYBR Green-I (3 citations) SYBR I (3 citations)

312 protocols using power sybr green rna to ct 1 step kit

Quantitative RT-PCR for AvCoV RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the supernatants of the reference virus and the wells from the escape mutant assay plate after clarification at 1000×g/4 °C/10 min using RNeasy® Mini kit (Qiagen).
RT-qPCR for AvCoV genomic RNA was carried out using a Power SYBR® Green RNA-to-Ct™ 1-Step kit (Applied Biosystems) following the manufacturer’s instructions and primers described by Callison et al. (2006 (link)) targeting the 5ʹUTR, with the assays performed in triplicate. RT-qPCR of β-actin as an endogenous control was performed using a Power SYBR® Green RNA-to-Ct™ 1-Step kit (Applied Biosystems) and IDT Integrated DNA Technologies proprietary primers 5'ACAGAGCCTCGCCTTTG3'/5'CCTTGCACATGCCGGAG3', with the reactions performed in duplicate.
RT–qPCR was carried out in a 7500 Real-Time PCR system (Applied Biosystems) (48 °C/30 min; 95 °C/10 min; 45 cycles of 95 °C/15 s and 60 °C/40 s; and melting curve analysis). Absolute quantification (number of copies/µl of sample) of AvCoV was obtained by comparison with a tenfold dilution standard curve with a plasmid containing the corresponding 5′UTR sequence of AvCoV ranging from 1 × 10³ to 1 × 10⁹ copies per reaction (slope = − 3.536 and y-intercept = 43.665) and normalized to the β-actin Cq value of each sample.

Brandão P.E., Berg M., Silva S.O, & Taniwaki S.A. (2022). Emergence of Avian coronavirus Escape Mutants Under Suboptimal Antibody Titers. Journal of Molecular Evolution, 90(2), 176-181.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative RT‐PCR was performed as described23. Briefly, total RNA was isolated using the RNeasy Mini Kit (Qiagen, Valencia, CA) and DNase‐treated with the TURBO DNA‐free kit (Life Technologies). The qRT‐PCR reactions were performed using Power SYBR Green RNA‐to‐CT 1‐Step Kit (Life Technologies) with the following PCR conditions: reverse transcription, 48°C for 30 min; 40 cycles of 95°C, 15 sec, 60°C, 1 min. Reactions without reverse transcriptase were included to verify the absence of genomic DNA. mRNA expression was normalized to GAPDH mRNA. Relative expression was determined using the 2^−ΔΔCT method. Primer sequences are presented in Table 1.

Bhalla A.D., Khodadadi‐Jamayran A., Li Y., Lynch D.R, & Napierala M. (2016). Deep sequencing of mitochondrial genomes reveals increased mutation load in Friedreich's ataxia. Annals of Clinical and Translational Neurology, 3(7), 523-536.

+ Open protocol

+ Expand

Quantitative Analysis of TGF-β Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols

After B16BL6-CAR/E1B55 cells were infected with the recombinant adenovirus for 2 days, cells were lysed with the Trizol reagent (Life Technologies, Carlsbad, CA, USA), and the total RNA was isolated using chloroform. The RNA concentration was determined using the Nanodrop 2000 (Thermo Fisher Scientific). The real-time PCR reaction was performed using the Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies). The reaction mixture contained the reverse transcriptase enzyme mix, reverse transcription PCR mix, forward primer, reverse primer, RNA template, and nuclease-free water. Mouse TGF-β1 cDNA was amplified using the forward primer 5′- TTGCTTCAGCTCCACAGAGA -3′ and the reverse primer 5′- TGGTTGTAGAGGGCAAGGAC -3′. Mouse TGF-β2 cDNA was amplified using the forward primer 5′-GTGAATGGCTCTCCTTCGAC-3′ and the reverse primer 5′-CCTCGAGCTCTTCGCTTTTA-3′. Mouse TGF-β3 cDNA was amplified using the forward primer 5′- CTATCAGGTCCTGGCACTTT-3′ and the reverse primer 5′- GGCAGATTCTTGCCACCTAT -3′. Mouse β-actin was amplified using the forward primer 5′-GGCTGTATTCCCCTCCATCG-3′ and the reverse primer 5′-CCAGTTGGTAACAATGCCATGT-3′.

Kim S.Y., Kang D., Choi H.J., Joo Y., Kim J.H, & Song J.J. (2017). Prime-boost immunization by both DNA vaccine and oncolytic adenovirus expressing GM-CSF and shRNA of TGF-β2 induces anti-tumor immune activation. Oncotarget, 8(9), 15858-15877.

+ Open protocol

+ Expand

Quantifying mRNA Expression via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with using Arcturus PicoPure™ RNA Isolation Kit (12204-01, Applied Biosystems) as per manufacturer’s instructions. QRT-PCR was performed with the Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies) and a Step One Plus Real-time PCR machine (Applied Biosystems). The amounts of mRNA were measured with SYBR Green PCR Master Mix (Ambion). Relative levels of transcript expression were assessed by the ∆∆Ct method, with Gapdh as an endogenous control. For qPCR primers used, see Supplementary Table 2.

Sozen B., Jorgensen V., Weatherbee B.A., Chen S., Zhu M, & Zernicka-Goetz M. (2021). Reconstructing aspects of human embryogenesis with pluripotent stem cells. Nature Communications, 12, 5550.

+ Open protocol

+ Expand

Repression of arT transcription by ArA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the repression of transcription of arT by ArA, arA was cloned into the NcoI and XbaI sites of pBAD-myc-His B (Life Technologies) using primers ArA-NcoI-f2 and ArA-XbaI-r. Ligated product was introduced into BW25113 ΔghoS ΔmqsRA ΔKm^R/pCA24N-arT via electroporation. As a positive control, pBAD-mqsA was also constructed in a similar manner, and electroporated into the same strain. For the negative control, pBAD-myc-His B (which expresses only the myc epitope and His tag) was electroporated into the same strain.
Independent cultures of the three strains (BW25113 ΔghoS ΔmqsRA ΔKm^R/pCA24N-arT with either pBAD-arA, pBAD-mqsA, or pBAD-myc-His B) were grown in LB-chloramphenicol-ampicillin to an OD₆₀₀ of 0.5, and 1% l-arabinose was added to induce production of MqsA or ArA. Cells were harvested after 30 min of induction, and total RNA was isolated as described in the following section. qRT-PCR was performed according to manufacturer's instructions (Power SYBR Green RNA-to-C_T1-Step kit, Life Technologies, Carlsbad, CA) using 100 ng of total RNA as the template. Primers were annealed at 60°C, and the housekeeping rrsG (16S rRNA) gene was used to normalize all data. Changes in gene transcripts were calculated using the 2^−ΔΔCt formula54 (link).

Soo V.W., Cheng H.Y., Kwan B.W, & Wood T.K. (2014). de novo Synthesis of a Bacterial Toxin/Antitoxin System. Scientific Reports, 4, 4807.

+ Open protocol

+ Expand

Quantifying mRNA Expression of TSPYL Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified using the Quick-RNA Miniprep Plus Kit (Zymo Research, Irvine, CA). For each reaction, 200 ng of total RNA was used for amplification of the target gene. mRNA levels for TSPYL1, TSPYL2, TSPYL4 and SLC6A4 were quantified by qRT-PCR using the PrimeTime® (IDT, Inc., Coralville, Iowa) pre-designed qPCR primers and the Power SYBR^® Green RNA-to-C_T 1-Step Kit (Life Technologies, Grand Island, NY). Gene expression analyses were performed using the ΔΔCt method, and ACTB was used as the internal reference gene. Three independent experiments were performed.

Qin S., Eugene A.R., Liu D., Zhang L., Neavin D., Biernacka J.M., Yu J., Weinshilboum R.M, & Wang L. (2019). Dual Roles for the TSPYL Family in Mediating Serotonin Transport and the Metabolism of Selective Serotonin Reuptake Inhibitors in Patients with Major Depressive Disorder. Clinical Pharmacology and Therapeutics, 107(3), 662-670.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Caco-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from Caco-2 cells was extracted using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Purity, integrity, and concentration were analyzed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Milan, Italy). RNA was reverse transcribed and amplified using the Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies, Monza, Italy) according to manufacturer’s instructions and applying the following thermal protocol: reverse transcription for 30 min at 48°C; Taq activation for 10 min at 95°C; 40 cycles of denaturation for 15 s at 95°C, and annealing/extension for 1 min at 60°C. Finally, melting curve analysis was performed in order to verify the proper product amplification. Optimal input RNA concentration for each gene was chosen using standard curve analysis of a pool of RNA samples. The human actin gene was selected as an internal standard. Primers were QuantiTect Primer Assay from Qiagen (Cat. numbers: actin, beta: QT01680476; GPX2: QT00200039). Measurements were performed in technical triplicate and repeated at least three separate times. Data in figures are expressed in Log₂ in order to provide symmetrical distribution of gene expression effects and reported as percentage of gene expression in control cells. All data are expressed as the ratio to the reference gene Actin.

Finamore A., Ambra R., Nobili F., Garaguso I., Raguzzini A, & Serafini M. (2018). Redox Role of Lactobacillus casei Shirota Against the Cellular Damage Induced by 2,2′-Azobis (2-Amidinopropane) Dihydrochloride-Induced Oxidative and Inflammatory Stress in Enterocytes-Like Epithelial Cells. Frontiers in Immunology, 9, 1131.

+ Open protocol

+ Expand

TGF-β Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed with Trizol reagent (Life Technologies, Carlsbad, CA, USA) and the total RNA was isolated via chloroform extraction. RNA concentration was determined with a Nanodrop 2000 (Thermo Scientific). The real-time polymerase chain reaction (PCR) was performed using a Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies). The reaction mixture contained the reverse transcriptase enzyme mix, reverse transcription PCR mix, forward primer, reverse primer, RNA template, and nuclease-free water. Human TGF-β1 cDNA was amplified using the forward primer 5′-CAAGGGCTACCATGCCAACT-3′ and the reverse primer 5′-AGGGCCAGGACCTTGCTG-3′. Human TGF-β2 cDNA was amplified using the forward primer 5′-GCTGCCTACGTCCACTTTACAT-3′ and the reverse primer 5′-ATATAAGCTCAGGACCCTGCTG-3′. Human β-actin was amplified using the forward primer 5′-ACTCTTCCAGCCTTCCTT-3′ and the reverse primer 5′-ATCTCCTTCTGCATCCTGTC-3′.

Kang D., Han Z., Oh G.H., Joo Y., Choi H.J, & Song J.J. (2017). Down-Regulation of TGF-β Expression Sensitizes the Resistance of Hepatocellular Carcinoma Cells to Sorafenib. Yonsei Medical Journal, 58(5), 899-909.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells using the RNeasy system (Qiagen) following the manufacturer’s instructions. Contaminating DNA was removed using the DNA-free Kit (Life Technologies). Quantitative reverse transcription PCR analysis was performed for both HEK293 cells and worm samples using Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies) following the manufacturer’s instructions, with 10 μl reactions. Each experimental repeat was run in triplicate. Primer sequences can be found in Supplementary Table 3. References for primer sequences available on request. Reference genes for quantification: human, RPL19; C. elegans, act-1 and tba-1. Changes in gene expression were quantitated using the ΔΔCt method^{45 (link)}, normalizing for each gene to the reference gene for the same sample and then to one control sample, as indicated in figure legends. The heat map in Figure 6c was generated using Multi Experiment Viewer software and represents the mean values of four independent experimental repeats (Supplementary Figure 4b).

Monaghan R.M., Barnes R.G., Fisher K., Andreou T., Rooney N., Poulin G.B, & Whitmarsh A.J. (2015). A nuclear role for the respiratory enzyme CLK-1/COQ7 in regulating mitochondrial stress responses and longevity. Nature cell biology, 17(6), 782-792.

+ Open protocol

+ Expand

Quantifying Mad2 Expression in Preimplantation Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zygotes were injected with 12 μM Mad2 (5′-GAGGACAGCTTTACTATTCAA-3′) or AllStars Negative Control (Qiagen) siRNA. Embryos were collected for quantitative reverse transcriptase–PCR (qRT–PCR) 48 h later at the eight-cell stage. Total RNA was extracted using the Arcturus PicoPure RNA Isolation Kit and qRT–PCR was performed using the Power SYBR Green RNA-to-CT 1-Step Kit (Life Technologies) and a StepOne Plus Real-time PCR machine (Applied Biosystems). The ddCT method was used to determine relative levels of mRNA expression, with Gapdh as an endogenous control. Mad2 primers: 5′-CTGACCCCGAGCTCATAAAGT-3′, 5′-ACTGAGCACTTGTACAGCCA-3′ and Gapdh primers: 5′-AGAGACGGCCGCATCTTC-3′, 5′-CCCAATACGGC CAAATCCGT-3′.

Bolton H., Graham S.J., Van der Aa N., Kumar P., Theunis K., Fernandez Gallardo E., Voet T, & Zernicka-Goetz M. (2016). Mouse model of chromosome mosaicism reveals lineage-specific depletion of aneuploid cells and normal developmental potential. Nature Communications, 7, 11165.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!