T100 pcr thermal cycler

The Ezup Column Bacterial Genomic DNA Extraction Kit was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The RAA nucleic Acid Amplification Kit was bought from Jiangsu Qitian Gene Biotechnology Co., Ltd. (Jiangsu, China). Oligonucleotides were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The oligonucleotide sequences used in this study are listed in Table S1. Cas12a was purchased from New England Biolabs. The Cas12/13 special nucleic acid test strip and 1 × Buffer were purchased from Guangzhou Bio-lifesci Co., Ltd. (Guangzhou, China). DEPC water (DNase-/RNase-free) and the Ribonuclease Inhibitor (RNase Inhibitor) were obtained from Beyotime Institute of Biotechnology (Shanghai, China). Tris-saturated Phenol was purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China). Gelstain was bought from TransGen Biotech Co., Ltd. (Beijing, China). All reagents were used as received and without further purification.
The oligonucleotide annealing process and RAA reaction were carried out by T100 Thermal Cycler PCR (from Bio-Rad, Tokyo, Japan). Gel imaging was performed using the Tanon 1200 imaging system. The fluorescence spectra were measured by the LightCycler96 qPCR (from Roche, Basel, Switzerland).

The TIANGEN amp Marine Animals DNA Kit (TIANGEN, Beijing, China) was used for the extraction of total genomic DNA in this experiment. A. japonicus muscle was selected instead of the body wall tissue, to avoid the influence of complex organic substances in the body wall, which might affect the quality of nucleic acids. The purity and integrity of the nucleic acids were initially checked by 1% agarose gel electrophoresis, and samples with clear electrophoretic bands and no or mild degradation were qualified. Qualified DNA samples were adjusted to 100 ng/μl and stored at -20 °C.
Qualified DNA samples were randomly fragmented into 350 bp fragments using a Covaris E220 ultrasonic DNA fragmentation machine (Shanghai Tusheng Vision Technology Co., Ltd., Shanghai, China). The library preparation process was completed on a T100 Thermal Cycler PCR (BIO-RAD, USA) instrument using KAPA HyperHlus reagent (Illumina, USA) after 10 cycles of end repair, addition of polyA tails, addition of sequencing adapters, and purification and amplification. High-throughput sequencing of samples was performed using the Illumina Nova6000 sequencing platform (Illumina, California, USA) with a 150 bp paired-end reads (LC-Bio, Hangzhou, Zhejiang Province, China).

Primers of exon 1–4 of ATP7B gene were designed by using Primer3 software (http://bioinfo.ut.ee/primer3-0.4.0/) (Table 3). A 2.5 μl DNA sample of each proband was amplified in 25 μl of PCR reaction containing 0.3 μl of Taq DNA Polymerase (5 U/μL ((Thermo Scientific Inc.), 2.5 μl of 2.5 mM deoxynucleotide. Triphosphate mixture, 0.5 μl of each forward and reverse primer (10 pmol/μl), 2.5 μl of 10 × reaction buffer (without MgCl2) and 2.5 μl of MgCl2 (25 mM). The PCR T100 thermal cycler (Bio-Rad, CA, USA) was used with a cycling program of initial denaturation temperature 95°C for 5 min, followed by 10 cycles of 95°C for 45 sec, 69°C– 64°C (according to melting temperature of each primer pair) for 45 sec with an increment of -1 in each subsequent cycle, 72°C for 45 sec again followed by 30 cycles of 95°C for 45 sec, 59°C– 54°C (according to melting temperature of each primer pair) for 45 sec, 72°C for 45 sec and a final extension at 72°C for 10 min followed by a final hold at 25°C. The amplification PCR products were loaded on the 1.5% agarose gel along with 1 kb size ladder to evaluate product size and purified by using DNA purification Kit (Wiz Bio Solutions, Seongnam, Korea).

The PCR technique was used to confirm the expression of the previously selected genes in spermatozoa RNA. As a positive control, a sample in which the presence of each gene was previously confirmed (human testis, human nasal ciliated cells (obtained by nasal brushing) or white blood cells (obtained from peripheral blood)) was included. The reaction mixture (20 μL) contained: 4 μL of FIREPol PCR Master Mix (Cat #. 04-12-00125, Solis BioDyne, Tartu, Estonia), 13 μL of DEPC treated water; 1 μL of each primer (Eurofins Genomics, Ebersberg, Germany) at 10 pmol/μL each, and 1 μL of cDNA at 40 pmol/μL. PCR conditions were optimized for each primer pair and was performed in a PCR T100 thermal cycler (BioRad, Hercules, CA, USA). PCR products were analyzed by 1.5% agarose gel electrophoresis; a mix of TAE 1x SeaKem LE Agarose (Lonza, Basel, Switzerland), and 5 μL/100 mL of GreenSafe Premium (MB13201, NZYTech).

For DNA sequencing of the ptsI and aceF genes, three sets of primers were prepared for each gene divided into three parts (Supplementary Table S5). Considering that the quality score of sequencing result was low in the front and back of the sequences, approximately 200 bp was left as a margin at the front and rear of the gene sequence, and each part was overlapped by approximately 300 bp. The gene was amplified using a PCR T100 thermal cycler (BioRad, Hercules, CA, USA) with genomic DNA of EcN as a template. The PCR product was purified using Expin PCR SV (GeneAll Biotechnology, Seoul, Korea). Sanger sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Thermo Fisher Scientific Inc., Waltham, MA, USA). The sequencing reaction was run using a DNA Engine Tetrad 2 Peltier Thermal Cycler (BioRad, Hercules, CA, USA), and each of the three parts was sequenced using three different forward primers. After removal of unincorporated dNTPs and other ingredients, the final products were loaded onto an ABI 3730xl DNA Analyzer (Applied Biosystems, Thermo Fisher Scientific Inc., Waltham, MA, USA) to obtain the sequencing results.

Fungi-specific PCR reactions were carried out using forward primer ITS1F CTTGGTCATTTAGAGGAAGTAA [28 (link)] and reverse primer ITS2 GCTGCGTTCTTCATCGATGC [29 ], producing amplicons of 320 bp using a protocol modified from [30 (link)]. PCR reactions were carried out in 25 μL total reaction volume using 2X Master Mix (New England Biolabs, Ipswich Massachusetts, MA, USA), 0.4 mM oligonucleotide primers synthesised by Eurofins (Ebersberg, Germany), 1 μL DNA (ca. 50–200 ng/μL) and performed on a BioRad T100 PCR thermal cycler. Cycling conditions were as follows: 95 °C for 2 min, followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and finalised by 10 min elongation at 72 °C. Products derived from PCR were visualised on a 2% agarose/TBE gel with GreenSafe premium nucleic acid stain (NZYTech, Portugal). Sanger sequencing was performed using both forward and reverse primers synthesised by Source BioScience (Nottingham, UK) and Eurofins. Sequences were deposited in GenBank under accession numbers MT000100-MT000103.