The open reading frames (ORFs) of CSNK2B (GenBank: NM_001320.7) and CSNK2A1 (GenBank: NM_177559.3) were cloned in pGEX4T1 (GE Healthcare) and pEGFP-C1. Identified variants of CSNK2B GenBank: NM_001320.7, c.94G>C, c.94G>A, and c.374G>C, were introduced in these plasmids by site-directed mutagenesis (Promega). Oligonucleotides sequences used to create variants of CSNK2B are shown in Table S2 . We obtained GFP-CTNNB1 plasmid as a donation from Prof. Carien Niessen (Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases [CECAD], University of Cologne). This plasmid contains the ORF of CTNNB1 (GenBank: NM_001904.4), which was excised and introduced into pGEX4T1 plasmid.
Site directed mutagenesis
Manufactured by Promega
Site-directed mutagenesis is a molecular biology technique used to introduce specific, controlled changes in the DNA sequence of a gene or plasmid. This method allows for the targeted modification of a DNA molecule, enabling the study of the effects of particular mutations or the creation of altered proteins.
Automatically generated - may contain errors
4 protocols using site directed mutagenesis
1
Cloning and Mutagenesis of CSNK2 Genes
2
HMGB1 3'UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′-UTR fragment of HMGB1, predicted to be the miRNA binding site, was synthesized and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI, USA) to generate a HMGB1-Wt luciferase reporter. Mutation of the binding site was introduced by site-directed mutagenesis (Promega), to yield Mut. For luciferase reporter assay, MG63 cells were cultured in 96-well plates and co-transfected with miR-505 mimics (or negative control) using Lipofectamine 2000. After transfection for 48 h, cells were harvested, and luciferase activity was assayed with the luciferase reporter assay system (Promega).
3
Identifying miR-154 Targets: RSF1 and RUNX2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The downstream targets of miR-154 were predicted using miRBase, miTarget and TargetScan. Putative complementary sequences for miR-154 were identified in the 3′-untranslated regions (3′-UTRs) of RSF1 and RUNX2 mRNA. The 3′-UTRs of RSF1 and RUNX2, containing the miR-154 target sequence, were synthesized and inserted into the XbaI and FseI sites of a pGL3 control vector (Promega, Madison, WI, USA) to generate a overall survival an RSF1-wild-type and RUNX2-wild-type luciferase reporter. Mutation of the binding site was performed using site-directed mutagenesis (Promega) to create the pGL3-RSF1- and pGL3-RUNX2-mutant type plasmids. For detection, T24 cells were cultured in 96-well plates and co-transfected with miR-1545 mimics (or miR-NC) and reporter plasmids using Lipofectamine 2000. After 48 h, the cells were assayed with a Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity for each sample was normalized to Renilla luciferase activity.
4
Unveiling VEGFC Promoter Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
VEGFC promoter‐luciferase plasmids were kindly provided by Dr Wen‐Chun Hung. Briefly, a serial of plasmids with deletion on the VEGFC promoter region (−1046/+38, −439/+38 and −185/+38) from the translational start site of the VEGFC gene were amplified by PCR from the genomic DNA. Three DNA fragments were subcloned into the luciferase reporter gene vector pGL3 to yield the luciferase reporter construct. In addition, an E‐box mutant (TACGTG instead of CACGTG) of the VEGFC promoter (−1046/+38) was created by site‐directed mutagenesis (Promega) using a pair of primer (forward: 5′‐CCCTGGACCACGTACAGCGGGGAGAAA‐3′, reverse: 5′‐TTTCTCCCCGCTGTACGTGGTCCAGGG‐3′; Figure S1 ). Control or c‐Myc–overexpressed 293T cells were seeded into 12‐well plates and transfected with serial VEGFC promoter‐luciferase plasmids (VEGFC‐1046/+38, VEGFC‐439/+38, and VEGFC‐185/+38). The seeded cells were harvested 24 hours later and the luciferase activities of the cells in each condition were measured by luciferase assay system (Promega Corporation) and detected by CentroLIApc LB 962. Relative luciferase unit (RLU) was normalized by protein concentration in cell lysates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!