The total RNA was isolated using the TRIZOL reagent (Invitrogen) and the phenol-chloroform extraction method according to the manufacturer's instruction. Total RNA (2 μg) was annealed with random primers at 65 °C for 5 min. The cDNA was synthesized using a 1st-STRAND cDNA Synthesis Kit (Fermentas, Pittsburgh, PA, USA). Quantitative real-time PCR was carried out using SYBR PremixExTaq (Takara Biotechnology, Dalian, China). The primers used for quantitative RT-PCR are as follows: human GAPDH, 5′-GAGTCAACGGATTTGGTCGT-3′ (forward) and 5′-GACAAGCTTCCCGTTCTCAG-3′ (reverse); mouse GAPDH 5′-AGTATGACTCCACTCACGGCAA-3′ (forward) and 5′-TCTCGCTCCTGGAAGATGGT-3′ (reverse); human CDC34, 5′- GACGAGGGCGATCTATACAACT-3′ (forward) and 5′- GAGTATGGGTAGTCGATGGGG-3′ (reverse); mouse CDC34, 5′- CCCCAACACCTACTATGAGGG-3′ (forward) and 5′- ACATCTTGGTGAGGAACCGGA-3′ (reverse); human EGFR, 5′-GGACTCTGGATCCCAGAAGGTG-3′ (forward) and 5′-GCTGGC CATCACGTAGGCTT-3′ (reverse); human CCND1, 5′- GCTGGAGCCCGTGAAAAAGA-3′ (forward) and 5′-CTCCGCCTCTGGCATTTTG-3′ (reverse). Each sample was analyzed in triplicate for three times.
1st strand cdna synthesis kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 1st-STRAND cDNA Synthesis Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. It provides the necessary reagents and enzymes to perform this reverse transcription process, which is a fundamental step in various molecular biology and genetic analysis techniques.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Chamq universal sybr qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Stepone plus equipment, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
Turbo dna freetm kit, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time instrument, by Bio-Rad (1 mentions)
Purelink plant rna reagent, by Thermo Fisher Scientific (1 mentions)
Steponeplus device, by Thermo Fisher Scientific (1 mentions)
Gel extraction kit, by Qiagen (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Rotor gene 6000, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Taqman fast universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
13 protocols using 1st strand cdna synthesis kit
1
Quantitative RT-PCR Expression Analysis
2
Stat3 ChIP and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For ChIP, the cells were treated or untreated with 6-OAP, harvested and fixed with formaldehyde. The DNA was sheared into small, uniform fragments using sonication, and specific protein/DNA complexes were immunoprecipitated using an antibody against Stat3 (#9139S, Cell Signaling Technology). Following immunoprecipitation, cross-linking was reversed, the proteins were removed by treatment with proteinase K, and the DNA was purified and analyzed by quantitative PCR (qPCR). For qRT-PCR, the cells were harvested, and the total RNA was isolated with the TRIzol Reagent (Invitrogen, Frederick, MD, USA) according to the manufacturer’s instruction. Total RNA (2 μg) was annealed with random primers at 65 °C for 5 min. The cDNA was synthesized using a 1st-STRAND cDNA Synthesis Kit (Fermentas, Pittsburgh, PA, USA). qRT-PCR was performed using SYBR Premix ExTaq™ (Takara Biotechnology, Dalian, China) and primers listed in Supplementary Table S3 .
3
Quantitative Real-Time PCR and ChIP Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human normal bronchial epithelial cell line 16HBE (Clonetics, Walkersville, MD), NSCLC line H460, murine LLC (the American Type Culture Collection (ATCC), Manassas, VA, USA), MC38, and Ag104Ld cells were cultured according to recommended protocols10 (link),52 . The total RNA was isolated using the TRIZOL Reagent (Invitrogen, Frederick, MD, USA) and the phenol-chloroform extraction method according to the manufacturer’s instruction. Total RNA (2 μg) was annealed with random primers at 65 °C for 5 min. The cDNA was synthesized using a 1st-STRAND cDNA Synthesis Kit (Fermentas, Pittsburgh PA, USA). Quantitative real-time PCR was carried out using SYBR Premix ExTaqTM (Takara Biotechnology, Dalian, China). Chromatin immunoprecipitation (ChIP) assay was performed using AhR-immunoprecipitated DNA samples and primers listed in Supplementary Table 2 .
4
RNA Extraction, cDNA Synthesis, and qPCR for CIP2A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of the cells was isolated using the TRIZOL Reagent (Invitrogen) and the phenol–chloroform extraction method, according to the manufacturer’s instruction. Total RNA (2 μg) was annealed with random primers at 65 °C for 5 min. The complementary DNA was synthesized using a 1st-STRAND cDNA Synthesis Kit (Fermentas, Hanover, MD, USA). For PCR amplification, primers are as follows: GAPDH, forward primer: 5′-
TCACCAGGGCTGCTTTTA-3′, reverse primer: 5′-
AAGGTCATCCCTGAGCTGAA-3′; CIP2A, forward primer: 5′-
CCATATGCTCACTCAGATGATGT-3′, reverse primer: 5′-
GTGTATCATCTCCACAGAGAGTT-3′.
TCACCAGGGCTGCTTTTA-3′, reverse primer: 5′-
AAGGTCATCCCTGAGCTGAA-3′; CIP2A, forward primer: 5′-
CCATATGCTCACTCAGATGATGT-3′, reverse primer: 5′-
GTGTATCATCTCCACAGAGAGTT-3′.
5
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using the TRIZOL reagent (Invitrogen) and the phenol-chloroform extraction method according to the manufacturer’s instruction. Total RNA (2 μg) was annealed with random primers at 65°C for 5 min. The cDNA was synthesized using a 1st-STRAND cDNA Synthesis Kit (Fermentas, Pittsburgh, PA). Quantitative real-time PCR was carried out using SYBR Premix ExTaq (Takara). The primer sequences for real-time PCR are listed in Figure 1—source data 1 . Each sample was analyzed in triplicate three times.
6
Quantitative PCR Analysis of G9a and Fbxw7
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by TRIzol reagent (Invitrogen) and reverse‐transcribed to cDNA with a 1st Strand cDNA Synthesis Kit (Thermo Scientific). PCR was performed with SYBR Green PCR Master Mix (Takara). All the steps were done according to the manufacturer's instructions. PCR primers are the following: for G9a, forward: 5′‐AGGCACCCAAGATTGACC‐3′, reverse: 5′‐GTCTCCCGCTTGAGGATG‐3′; for Fbxw7, forward: 5’‐GGCGCCGCGGCTCTTTTCTA‐3′, reverse: 5’‐GCTGCCCACAGAGAGCAGTTCC‐3′.
7
Cloning and Expression of HN1L in Insect Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from BmN cells was extracted by Trizol reagent (Pufei Biotech, Shanghai, China)
according to the manufacturer’s recommendations. The single-strand cDNA was carried out
using the 1st strand cDNA synthesis kit (Thermo Fisher Scientific, MA, USA). Based on the
HN1L sequence, specific primers were designed in order to amplify the
gene sequence with relevant restriction sites for the enzymes BamH and
Xho. The HN1L fragments were amplified by PCR,
digested by BamH and Xho and then ligated to the
BamH/Xho-digested pIEX-1 vector, which contained
His-tag. This resulted in the production of the overexpression plasmid
pIEX-1-HN1L. Similarly, the recombinant plasmid
pIEX-1-HN1L-eGFP was constructed. All clones were confirmed by
restriction enzyme digestion and nucleotide sequence analysis.
according to the manufacturer’s recommendations. The single-strand cDNA was carried out
using the 1st strand cDNA synthesis kit (Thermo Fisher Scientific, MA, USA). Based on the
HN1L sequence, specific primers were designed in order to amplify the
gene sequence with relevant restriction sites for the enzymes BamH and
Xho. The HN1L fragments were amplified by PCR,
digested by BamH and Xho and then ligated to the
BamH/Xho-digested pIEX-1 vector, which contained
His-tag. This resulted in the production of the overexpression plasmid
pIEX-1-HN1L. Similarly, the recombinant plasmid
pIEX-1-HN1L-eGFP was constructed. All clones were confirmed by
restriction enzyme digestion and nucleotide sequence analysis.
8
Quantifying Gene Expression in Frozen Cotyledons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen cotyledons (collected at 0-, 1-, 3-, 7-, and 11-dpi) were ground in liquid nitrogen with a sterilized pestle and mortar. Total RNA was extracted using PureLink® Plant RNA Reagent (Invitrogen, Carlsbad, CA, USA) and treated with a TURBO DNA-freeTM Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Reverse transcription of the first-strand cDNA was performed using the 1st-Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA) with 1 μg of total RNA. Next, 4.2 μL of 100-fold diluted cDNA, 5 μL of PowerUp™ SYBR™ Green Master Mix (Clontech, Palo Alto, CA, USA), and 0.4 μL of each primer (10 mM) were used for PCR reaction. Primer sequences are shown in Table 2 . Real time quantitative PCRs were performed on a CFX96 Real-Time Instrument (Bio-Rad, USA) with the amplification program of 50 °C for 2 min, 95 °C for 2 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min. Melting curve analysis was performed by increasing 0.5 °C at 5 s/step from 65 to 95 °C. The relative gene expression level was calculated using the 2−ΔΔCT method [76 (link)].
9
Quantitative PCR Analysis of Porcine Immune Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Porcine alveolar macrophages grown in 24-well plates (2–3 × 105 cells) were subjected to different treatments. The treated cells were harvested and RNA extracted with TRIpure Reagent. The extracted RNA was reverse transcribed into cDNA with HiScript® 1st Strand cDNA Synthesis Kit, then the target gene expressions were measured by quantitative PCR with ChamQ Universal SYBR qPCR Master Mix using StepOne Plus equipment (Applied Biosystems). The qPCR program is denaturation at 95°C for 30 s followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. The qPCR primers for pIFNβ, pISG56, pTNF-α, pβ-actin, H9N2-HA, H9N2-M, H1N1-M, HSV-1, VSV, EMCV, and GFP are shown in Table 1 . The transcriptional levels of target genes were quantified using the ΔΔCT calculation method.
10
Quantifying Porcine RLR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heart, liver, spleen, lung, kidney and lymph node tissues were collected from 10–30-week-old euthanized pigs infected with a high-pathogenic porcine respiratory and reproductive syndrome virus (HP-PRRSV), as well as normal control pigs, and RNAs were extracted with TRIpure reagent from the ground tissues. The extracted RNA was reverse transcribed to cDNA using the HiScript® 1st Strand cDNA Synthesis Kit, and target gene expressions were measured by quantitative PCR (qPCR) using the ChamQ Universal SYBR qPCR Master Mix performed on a StepOne Plus device (Applied Biosystems, Waltham, MA, USA). The qPCR program was denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. The qPCR primers for pRIG-I, pMDA5 and pLGP2 are shown in Table 2 . The ΔΔCT method was used to quantify the transcription levels of the porcine RLR genes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!