Lightcycler software

The designed primers were checked in RT-qPCR, performed by Light Cycler 96 (Roche, Basel, Switzerland). Commercial premix (Evrogen) containing SYBR Green I, polymerase, dNTPs, and buffer was supplemented with 6 U/µL MMLV, 0.2 U/µL RNAse inhibitor, and 2 mM DTT. Primers were added in different combinations at a concentration of 200 nM. Transcribed AMV RNA3 Δ or total extract from plants was added in different concentrations. The PCR analysis comprised the RT stage at 42 °C for 20 min, then denaturation at 95 °C for 5 min, followed by 45 cycles. Each cycle contained denaturation at 95 °C for 30 s, primer annealing at 55 °C for 30 s, and elongation at 72 °C for 40 s. SYBR Green fluorescence was detected within the elongation stages. A cycle threshold (Ct) was computed automatically by Light Cycler software (Roche, Basel, Switzerland).

Isolation of total RNA, cDNA synthesis and qRT-PCR were performed as previously described.^{18 (link)} Roche LightCycler software (LightCycler 480 Software Release 1.5.0) was used to perform advanced analysis relative quantification using the 2(−ΔΔC(T)) method. Expression data were normalized to the reference gene Gapdh (primers from Qiagen, Hilden, Germany). Primer sequences (all Eurofins Genomics, Ebersberg, Germany) are listed in Supplementary Table S5.

Using Advantage RT-for-PCR kit (Clontech, Mountain View, CA, USA), we reverse-transcribed 500 ng of total RNA from the CT group (n = 9), SR group (n = 8), SS group (n = 7), YSR group (n = 12), and YSS (n = 8) into cDNA. Quantitative polymerase chain reaction (PCR) was carried out as described by our published protocol [43 (link)]. The gene-specific primers were synthesized from the Synthesis and Sequencing Facility of Johns Hopkins University (Baltimore, MD, USA) based on the PCR primers we generated using LightCycler probe design software v. 2.0 (Roche Biosystems, Indianapolis, IN, USA). The list of primers used is given in Table S1. Quantitative reverse transcription PCR was performed using the Roche LightCycler 480 II with iQ SYBR Green Supermix (Bio-Rad). A standard curve method was used to determine the concentration of unknown samples. The raw data was obtained using a second derivative maximum analysis via a non-linear, polynomial regression line (Roche Light cycler software). Data reported uses absolute quantification. Within each sample, the relative amounts of mRNA analyzed were normalized using two reference genes Clathrin and 18S. The results are shown as fold changes calculated as the ratios of normalized gene expression data for METH-treated groups (SR and SS) compared to its respective yoked shock groups (YSR and YSS) and to the CT control group.

Different concentrations of the target DNA were added to the solution containing 200 nM of the designed primer pairs (Table 1) and a commercial SYBR Green I–qPCR mix (Evrogen). The final volume of the reaction was 10 µL. Real-time quantitative PCR was performed using a LightCycler 96 device (Roche, Switzerland). The analysis required 45 cycles, with the detection of fluorescence performed after each cycle. The PCR cycle involved a denaturation stage at 95 °C for 30 s, a primer annealing stage at 66 °C for 30 sec, and an elongation stage at 72 °C for 30 s. The threshold cycle (Ct) was computed automatically using the LightCycler software (Roche, Basel, Switzerland).

Total RNA samples were extracted from the brain vessels using RNAiso Plus reagent (Takara Bio Inc., Otsu, Shiga, Japan) according to the manufacturer’s instructions. The total RNA (1 μg) from each sample was reverse-transcribed into cDNA using Primescript^TM 1st strand cDNA synthesis kit (Takara Bio Inc., Otsu, Shiga, Japan) using C1000 Touch^TM Thermal Cycler (Bio-Rad, Hercules, CA, United States). The levels of gene expression were quantified by real-time PCR using SYBR^®Premix Ex Tag^TM II (Tli RNaseH Plus, Takara Bio Inc., Otsu, Shiga, Japan) and LightCycler^® 480 II Real time PCR instrument (Roche, Mannheim, BW, Germany). The sequences of the primers were as follows: P-gp: forward, 5′–ACAGAGGATCGCC ATTGCCC–3′, and reverse, 5′–TGGTGGTCCGGCCTTCT CTA–3′, (GenBank: NM_133401), and β-actin: forward, 5′–CAC GATGGAGGGGCCGGACTCATC–3′, and reverse: 5′–TAAA GACCTCTATGCCAACACAGT–3′) (GenBank: NM_031144). The β-actin gene was amplified separately as an internal control to normalize for P-gp expression using the LightCycler^® software (Roche, Mannheim, BW, Germany).

We used a qPCR-based method as published previously [27 (link)], which is similar to the one used by Laimer et al. [21 (link)]. In short, a telomere-specific primer (forward primer 5′-cggtttgtttgggtttgggtttgggtttgggtttgggtt-3′, reverse primer 5′-ggcttgccttacccttacccttacccttacccttaccct-3′) was used to determine relative telomeric length using a GoTaq Real Time PCR system (Promega). Input was normalized to the single copy gene 36B4 (forward primer 5′-cagcaagtgggaaggtgtaatcc-3′, reverse primer 5′-cccattctatcatcaacgggtacaa-3′) run under the same conditions. qPCR was performed on a LightCycler 480 System (Roche, Switzerland) using LightCycler software (Roche). Cycling conditions for both targets consisted of an initial 95 °C step for 10 min followed by 50 cycles of 95 °C for 15 s and 60 °C for 1 min. All samples were run at the same time for a total of two times. Delta C_T method was used to calculate results; results are given in arbitrary units (a.u.).