Wash buffer a

RNA FISH was performed with Stellaris^® RNA FISH products from Biosearch Technologies (Hoddesdon, UK) according to the manufacturer’s instructions. Briefly, after the incubation with secondary antibodies from immunocytochemistry, the primary hippocampal neurons were washed several times with PBS. Then, the neurons were fixed in 4% PFA once again for 20 min at room temperature. Then, the neurons are washed with Wash Buffer A (Biosearch Technologies) for 5 min at room temperature, after several washes with PBS. While washing, custom probes that target Cfl1 mRNA (Biosearch Technologies) and Hybridization Buffer (HB; Biosearch Technologies) were mixed in the ratio noted by the instructions. After the wash, the neurons are incubated with the probe–HB solution for 4 h at 37 °C. Then, the neurons were washed with Wash Buffer A for 30 min and with Wash Buffer B (Biosearch Technologies) for an additional 5 min at room temperature, before being mounted on the slide glass. “n” represents the number of independent experiments.

The cells were seeded onto Millipore slides. Cells were then fixed and permeabilized with fixation solution (methanol: acetic acid = 3:1) for 10 min, followed by washing for 5 min in Wash Buffer A (Biosearch Technologies) supplemented with deionized formamide. Then cells were hybridized with ZEB1 probes in hybridization buffer (Biosearch Technologies) supplemented deionized formamide overnight at 37 °C, and washed with fresh Wash Buffer A for 30 min at 37 °C. Subsequently, cells were counterstained with 5 µg mL⁻¹ DAPI for 5 min at 37 °C, followed by washing with Wash Buffer B (Biosearch Technologies) for 5 min. Finally, anti‐fade mounting medium (KeyGEN) was added to the slides and the cells were imaged using a ZEISS confocal laser microscope. The sequences of the anti‐ZEB1 probes with FITC tags are provided in Table S4, Supporting Information.

U2OS cells stably expressing SARS-CoV-2 N protein with a carboxyl-terminal Clover tag were a gift from the Cleveland lab at the University of California San Diego (UCSD). Cells were cultured in phenol-negative DMEM media supplemented with 10% FBS and 1% PS at 37°C with 5% CO₂. Prior to imaging, cells were transferred to glass-bottomed plates (Nunc Lab-Tek, 0.4 mL working volume) at approximately 25% confluence. Cells were transfected with a construct expressing N-MS2 RNA (the N cDNA sequence with 6 upstream stop codons and 3 carboxyl-terminal MS2 repeats) as described above. Cells were induced with doxycycline at a final concentration of 1,000 ng/mL and allowed to express for 14 hours. FISH was performed following the Stellaris RNA FISH protocol for adherent cells. Cells were fixed with 3.7% formaldehyde, permeabilized with 70% ethanol, and incubated in the dark at 37°C overnight with hybridization buffer (Biosearch Technologies, Middlesex, UK) supplemented with 10% deionized formamide and either 125 nM Cy3-(d)T20 oligonucleotides (Gene Link, Florida, USA) or 1 μM Cy3-MS2 probe (IDT (Iowa, USA), sequence AGGCAATTAGGTACCTTAGG) [19 (link)]. Cells were washed with wash buffer A (Biosearch Technologies, Middlesex, UK) for 30 minutes, then incubated with DRAQ5 1:1,000 in wash buffer A for 30 minutes and exchanged into wash buffer B (Biosearch Technologies) before imaging.