Evagreen

Manufactured by Bio-Rad

Sourced in United States, Denmark

EvaGreen is a fluorescent dye used in real-time PCR applications. It is a DNA-binding dye that emits a fluorescent signal upon binding to double-stranded DNA.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SsoFast EvaGreen Supermix (1774 citations) SsoFast EvaGreen Supermix kit (124 citations) EvaGreen Supermix (113 citations) Ssofast EvaGreen kit (13 citations) SsoFast Evagreen mix (11 citations) SsoFast EvaGreen reagents (11 citations) Droplet Generation Oil for EvaGreen (8 citations) SsoFast EvaGreen Supermix reagent (8 citations) Fast EvaGreen Supermix (7 citations) 2xQX200 ddPCR EvaGreen SuperMix (5 citations)

51 protocols using evagreen

Quantifying Circulating miRNAs by ddPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quantity of selected miRNAs was verified in serum samples by ddPCR using QX200™ Droplet Digital™ PCR System (Bio-Rad, CA, USA). cDNA synthesized as above was diluted 20-fold, and 9 µl was assayed in a 20-µl reaction volume according to the manufacturer’s protocol for microRNA PCR profiling using microRNA LNA™ PCR primer sets (Exiqon A/S, Denmark) and EvaGreen (Bio-Rad, CA, USA) with the QX200™ Droplet Digital™ PCR System (Bio-Rad, CA, USA) and thermal cycling conditions recommended for EvaGreen assays. After PCR, plates were loaded into a QX200™ Droplet Reader (Bio-Rad, CA, USA) to count PCR-positive and PCR-negative droplets. ddPCR results were analyzed with QuantaSoft™ software v.1.7.4.0917 and QuantaSoft™ Analysis Pro software v.1.0.596 (Bio-Rad, CA, USA). A no template control (NTC) was included in every assay. The miRNA concentrations were calculated using Poisson statistics and background-corrected based on the NTC. Absolute miRNA levels were initially computed in copies/μl PCR reaction and then corrected for the input amount of serum; final results were presented as copies/µl serum.

Maciejak A., Kostarska-Srokosz E., Gierlak W., Dluzniewski M., Kuch M., Marchel M., Opolski G., Kiliszek M., Matlak K., Dobrzycki S., Lukasik A., Segiet A., Sygitowicz G., Sitkiewicz D., Gora M, & Burzynska B. (2018). Circulating miR-30a-5p as a prognostic biomarker of left ventricular dysfunction after acute myocardial infarction. Scientific Reports, 8, 9883.

+ Open protocol

+ Expand

Investigating Gene Expression in Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cultured cells, using TRIzol reagent (Invitrogen) and reverse transcribed, using iScript cDNA synthesis kit (Bio-Rad USA). The primers sequences were: Myd88 Forward: 5′TGCCCTGAAGACTGTTCTGA3′ Reverse 3′ACTGGTTCCATGCAGGACAT5′, IRAK-4 Forward 5′TGATGGAGATGACCTCTGCT 3′, Reverse 3′GGTGGAGTACCATCCAAGCA5′and NF-kB1p65 Forward 5′ ATCCCATCTTTGACAATCGTGC Reverse 3′ CTGGTCCCGTGAAATACACCTC. Real-time PCR was performed using EVA Green (Bio-Rad, USA) on a spectrofluorometric thermal cycler (Mini Opticon, Bio-Rad). PCR was performed in duplicates as follows: 95°C for 10 min, and 45 cycles of 95°C for 15s, 60°C for 30s, and 72°C for 30s. All samples were normalized to the amount of GAPDH transcript present in each sample.

Devalraju K.P., Neela V.S., Gaddam R., Chaudhury A., Van A., Krovvidi S.S., Vankayalapati R, & Valluri V.L. (2018). Defective MyD88 and IRAK4 but not TLR-2 expression in HIV+ individuals with latent tuberculosis infection. Cytokine, 110, 213-221.

+ Open protocol

+ Expand

Quantifying Fungal and Bacterial Biomass during Pollen Degradation

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to investigate the biomass-dynamics of fungi and bacteria during pollen degradation, we followed molecular quantities of ribosomal gene copies. For qPCR, we used EvaGreen (BioRad) with a 25–500 pg template in a total volume of 13 µl; a CFX96 cycler (BioRad); our newly designed primer pair QRTfungf and QRTfungr to quantify fungal ribosomal copy numbers (cycling conditions: 98°C for 2 min followed by 40 cycles of 98°C for 10 sec, 60°C for 8 sec, and 65°C for 15 sec); and primer pair Ba519f and Ba907r for ribosomal bacterial genes (under conditions according to [60] (link) and [61] (link)). A purified and quantified PCR product (Qiagen PCR Purification Kit) served as the standard for a dilution series in 1∶10 dilution steps. Quality control was ensured using meltcurve analysis following amplification and agarose gel electrophoresis with randomly chosen qPCR reactions. Fungal copy numbers roughly followed the values of prevalence of infection from [20] (r = 0.67).

Wurzbacher C., Rösel S., Rychła A, & Grossart H.P. (2014). Importance of Saprotrophic Freshwater Fungi for Pollen Degradation. PLoS ONE, 9(4), e94643.

+ Open protocol

+ Expand

Quantitative Analysis of Endothelial and Hematopoietic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from zebrafish endothelial cells, HSPCs, and HUVECs using the RNeasy Plus Mini kit (QIAGEN). Complementary DNA was reverse transcribed using the SuperScript III RT kit (Thermo Fisher Scientific) and a mixture of poly-A and random hexamer primers. Quantitative PCR was performed using SSOFast Supermix with EvaGreen (Bio-Rad Laboratories) and a Bio-Rad thermal cycler. The following primer sequences were used in the study: zf-18s: 5′-TCGCTAGTTGGCATCGTTTATG-3′ (forward), 5′-CGGAGGTTCGAAGACGATCA-3′ (reverse); zf-cxcl8: 5′-TCATTGAAGGAATGAGCTTGAGAG-3′ (forward), 5′-CCAGTTGTCATCAAGGTGGC-3′ (reverse); zf-cxcr1: 5′-GTGATCGTACGCGCTATGGA-3′ (forward), 5′-ATTCGGGTTGCTAATCGCCA-3′ (reverse) ; hs-CXCL12: 5′-ACATGGCTTTCGAAGAATCG-3′ (forward), 5′-GCTGGTCCTCGTGCTGAC-3′ (reverse); hs-survivin: 5′-TTGGTGAATTTTTGAAACTGGA-3′ (forward), 5′-CTTTCTCCGCAGTTTCCTCA-3′ (reverse); hs-VEGFa: 5′-AGGGCAGAATCATCACGAAGT-3′ (forward), 5′-AGGGTCTCGATTGGATGGCA-3′ (reverse) ; hs-CXCL8 5′-AAATTTGGGGTGGAAAGGTT-3′ (forward), 5′-TCCTGATTTCTGCAGCTCTGT-3′ (reverse).

Blaser B.W., Moore J.L., Hagedorn E.J., Li B., Riquelme R., Lichtig A., Yang S., Zhou Y., Tamplin O.J., Binder V, & Zon L.I. (2017). CXCR1 remodels the vascular niche to promote hematopoietic stem and progenitor cell engraftment. The Journal of Experimental Medicine, 214(4), 1011-1027.

+ Open protocol

+ Expand

Quantitative RT-PCR analysis of MLL-ENL gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

MLL-ENL gene expression was confirmed by qRT-PCR experiments as previously described [85 (link)]. Briefly, cells were lysed using RLT buffer and RNA purification was performed using an RNA purification kit (Nordic BioSite). SuperScript III First-Strand Synthesis System (Thermo Fisher) was used for cDNA synthesis, and qRT-PCRs were run with EvaGreen (Bio-Rad). Expression levels were normalized to B-actin. The following primers were used: forward: gcagatggagtccacaggat and reversed: cccagctctaacctcacctg.

Pimkova K., Jassinskaja M., Munita R., Ciesla M., Guzzi N., Cao Thi Ngoc P., Vajrychova M., Johansson E., Bellodi C, & Hansson J. (2022). Quantitative analysis of redox proteome reveals oxidation-sensitive protein thiols acting in fundamental processes of developmental hematopoiesis. Redox Biology, 53, 102343.

+ Open protocol

+ Expand

Quantifying Ncl mRNA Levels in DRG Neurons

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RT–qPCR RNA was extracted from DRG neurons cultured in Boyden chambers as previously described (Willis & Twiss, 2011 (link)). cDNA was prepared from 500 ng of RNA, using SuperScript™ III First‐Strand Synthesis System (Thermo Scientific, 18080051). Quantitative real‐time PCR (qPCR) was performed using the PerfeCTa SYBR green FastMix (Quanta Biosciences) and gene‐specific primers for Inpp5f and Gapdh, on the ViiA‐7 system (Thermo Fisher Scientific). For RT‐ddPCR, RNA was isolated from DRG neurons, using RNeasy Microisolation Kit (QIAGEN). Fluorimetry with Ribogreen (Life Technologies) was used for RNA quantification; 20 ng of RNA was used for reverse transcription (RT) with SensiFAST cDNA synthesis kit (Bioline) according to the manufacturer’s protocol. ddPCR was performed using custom Ncl mRNA‐specific primer sets (IDT; forward primer: 5′CGGAAGAGGCGGATTTGG3′; reverse primer: 5′GGAAAGAATGGGATGGAAGGA3′) and detected with Evagreen using a QX200TM droplet reader (Bio‐Rad).

Doron‐Mandel E., Koppel I., Abraham O., Rishal I., Smith T.P., Buchanan C.N., Sahoo P.K., Kadlec J., Oses‐Prieto J.A., Kawaguchi R., Alber S., Zahavi E.E., Di Matteo P., Di Pizio A., Song D., Okladnikov N., Gordon D., Ben‐Dor S., Haffner‐Krausz R., Coppola G., Burlingame A.L., Jungwirth P., Twiss J.L, & Fainzilber M. (2021). The glycine arginine‐rich domain of the RNA‐binding protein nucleolin regulates its subcellular localization. The EMBO Journal, 40(20), e107158.

+ Open protocol

+ Expand

mRNA Extraction and qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from renal tissues or cells using a FACSAria (BD Biosciences) or autoMACS using RNAiso (TaKaRa Bio Inc.) or ReliaPrep RNA Cell Miniprep System (Promega), respectively. Total RNA was reverse transcribed to cDNA using a high‐capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was then performed on the cDNA samples using EvaGreen (Bio‐Rad). The relative quantification value is expressed as 2^−ΔCt, in which ΔCt is the difference between the mean Ct value of triplicate measurements and the endogenous GAPDH control.

Sakai R., Ito M., Yoshimoto K., Chikuma S., Kurasawa T., Kondo T., Suzuki K., Takeuchi T., Amano K, & Yoshimura A. (2020). Tocilizumab monotherapy uncovered the role of the CCL22/17‐CCR4+ Treg axis during remission of crescentic glomerulonephritis. Clinical & Translational Immunology, 9(11), e1203.

+ Open protocol

+ Expand

Quantitative RT-PCR of Streptococcus mutans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative reverse transcription PCR (qRT-PCR) was performed with the cDNA products described above (diluted 1:39) as the templates. Amplification was performed in a CFX96 real-time system with EvaGreen as the intercalating dye (Bio-Rad, Hercules, California) and 500 nM sod, dpr, tpx, sloC, or hk11 primers (see Table 2). RT⁻ and NTC controls were run simultaneously with the same primers for each cDNA template to verify the absence of contaminating genomic DNA. The PCR thermal cycling program was set as follows: 95°C for 3 min followed by 40 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 15 s. Primer efficiency was calculated using a standard curve with three 5X serial dilutions of UA159 control cDNA, and each amplification was performed in triplicate for N = 3 independent experiments. Expression of the sod, tpx, dpr, and sloC genes was normalized against that of hk11, an endogenous control gene with steady state expression under the experimental test conditions. Expression under aerated conditions was further normalized relative to the expression in control cultures to allow for direct comparison between the S. mutans UA159 wild-type and GMS584 SloR-deficient strains.

Crepps S.C., Fields E.E., Galan D., Corbett J.P., Von Hasseln E.R, & Spatafora G.A. (2016). The SloR Metalloregulator is Involved in the Streptococcus mutans Oxidative Stress Response. Molecular oral microbiology, 31(6), 526-539.

+ Open protocol

+ Expand

Quantifying Gene Expression in Mouse Skin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from whole skin of each genotype mouse at P9 or
fibroblasts culture using Trizol reagent (Invitrogen) and RNeasy kit (Qiagen)
according to manufacturer's instructions. Complementary DNA (cDNA) was
synthesized by iScript cDNA Synthesis Kit (Bio-Rad). Real-time PCR analysis was
performed with primers shown in Table 1 using a CFX96
Touch Real-Time PCR Detection System (Bio-Rad). Reactions were performed using
SsoFast qPCR Supermixes with EvaGreen (Bio-Rad) and experiments were carried out
in triplicate from cDNA isolated from three different animals. Gene expression
was normalized to actin expression levels as reference.

Nakasaki M., Hwang Y., Xie Y., Kataria S., Gund R., Hajam E.Y., Samuel R., George R., Danda D., M.J. P., Nakamura T., Shen Z., Briggs S., Varghese S, & Jamora C. (2015). The matrix protein Fibulin-5 is at the interface of tissue stiffness and inflammation in fibrosis. Nature Communications, 6, 8574.

+ Open protocol

+ Expand

RT-qPCR Analysis of Retinal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR experiment was performed on at least three mice per condition. Total RNA was extracted from a single retina using RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. RNA quantity was assessed using the NanoDrop 2000c UV-Vis spectrophotometer (Thermo Fisher Scientific). Total RNA (500 ng) was reverse transcribed in the presence of oligo-(dT)20 using Superscript II reagents (Thermo Fisher Scientific). For each RT-qPCR, cDNA was used in the presence of EvaGreen (Bio-Rad), and the reactions were performed in triplicates on a CFX96 Real-Time PCR Detection System (Bio-Rad). Differential expression analysis was performed using the ∆∆Ct method and normalised using the geometric mean expression of two housekeeping gene, Rps26 and Srp72²⁵. For each gene, the relative expression in each sample was calculated using the mean of the controls as the reference (1 a.u.). Primers used are listed in Supplementary Table S1.

Masson C., García-García D., Bitard J., Grellier É.K., Roger J.E, & Perron M. (2020). Yap haploinsufficiency leads to Müller cell dysfunction and late-onset cone dystrophy. Cell Death & Disease, 11(8), 631.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!