Lightcycler 96 qrt pcr system

The total RNA was isolated from the cells by using TRIzol reagent, as per the manufacturer’s instructions. Moreover, the RNA samples were treated with RNase-free DNase and subjected to reverse transcription with PrimerScript RT Reagent Kit. The NanoDrop 2000C Spectrophotometer (Thermo Fisher Scientific, USA) was used to detect the RNA purity and concentration of each sample, while a qRT-PCR analysis was performed in technical triplicate using the TB Green qRT-PCR kit with a Roche LightCycler 96 qRT-PCR system (Roche, Germany). All the data were generated using cDNA from triplicate wells for each condition. Furthermore, the comparative CT method was used to calculate the relative quantity of the target gene messenger RNA (mRNA), and GAPDH gene was used as the internal control. The following procedure was followed for the qRT-PCR experiments: 30 s at 95°C, followed by 40 cycles of 5 s at 95°C and 30 s at 60°C. PCR analysis was performed with human primer sets (forward and reverse, respectively) for Rictor: F’- CGAGTACGAGGGCGGAAT, R’- ATCTGGCCACATTTTGGAGA; HMOX1: F’-TGCTCAACATCCAGCTCTTTGA, R’- AACTGTCGCCACCAGAAAGC; GAPDH: F’- CAACGAATTTGGCTACAGCA, R’- AGGGGTCTACATGGCAACTG.

TRIzol reagents were used to isolate total RNA. RNase-free Dnase was added to remove DNA. The RNA was then reverse transcribed. Sequentially, qRT-PCR analysis was conducted in technical triplicate in a Roche LightCycler^®96 qRT-PCR system (Roche, Penzberg, Germany) to determine the relative levels of target mRNA [33 (link)]. The primers of the target genes used are listed in Table 1.

Total RNA was extracted from cells using TRIzol reagent (Vazyme, China), and quantitative determination of RNA concentration was performed by spectrophotometry (Thermo, Waltham, MA, USA). Total RNA was reverse transcribed into cDNA using HiScript II Q RT SuperMix for qRT–PCR (+ gDNA wiper) (Vazyme, Nanjing, China). qRT–PCR was performed on a LightCycler® 96 qRT–PCR system (Roche, Basel, Switzerland) with ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). β-actin was used as an internal reference gene for mRNA, and U6 was used as the internal reference gene for miRNA. The relative expression levels were analyzed with the 2^−ΔΔCt method. The experiments were performed with a minimum of three technical replicates, and all data are presented as the mean ± standard error of the mean. The primer sequences are listed in Table S2.

Human ovarian cancer tissues and adjacent noncancerous tissues were collected, and total RNA was extracted using TRIzol Reagent (Invitrogen) according to the kit instructions. 1 μg of total RNA was reverse‐transcribed to cDNA using the cDNA Reverse Transcription kit (Vazyme, Nanjing, China) at 37 °C for 60 min. Real-time PCR was performed using TB Green™ Premix Ex Taq™ II (RR420A; Takara, China) in a Roche LightCycler®96 qRT-PCR system according to the manufacturer’s protocol. Primers for IRF6 (interferon regulatory factor 6) were, forward: 5′- CCCCAGGCACCTATACAGC-3′ and reverse: 5′- TCCTTCCCACGGTACTGAAAC-3′; GAPDH was used as an internal reference for the calculation of IRF6 RNA expression, expression difference was calculated using 2^−ΔΔCT method.