Oligo primers

Paw tissues stored in RNALater^® were homogenized, and total RNA extraction was carried out according to the TRIzol (Thermo-Scientific^®, UK) method. Total RNA samples were quantified with the help of a Nanodrop spectrophotometer. Reverse transcription was performed using the cDNA synthesis kit (cat#679029, Thermo-Scientific^®, UK), according to the manufacturer’s instructions. For amplification and quantification, Maxima Syber Green/ROX Master Mix 2X (cat#896415, Thermo-Scientific^®, UK), nuclease-free water (cat#AM9932, Ambion^®, Naugatuck, CT, USA), and oligo-primers (Macrogen^®, Rockville, MD, USA)—TNF-α (F– 5′CACTCTTTCCAGGCCTTTGGG3′, R–5′GCATAGGTCTTCCTGCGGTCA3′), IL-1β (F–5′GCACAGTTCCCCAACTGGTA3′, R–5′GGAGACTGCCCATTCTCGAC3′), and IL-6 (F–5′CATTCTGTCTCGAGCCCACC3′, R–5′TGTGGGTGGTATCCTCTGTGA3′)—were utilized, and analysis was conducted using a thermal cycler (iQ5 Bio-Rad). Finally, the qRT-PCR data were analyzed using the 2^−ΔΔCt method, keeping β-actin as a reference gene to determine relative mRNA expressions.

2.2-Diphenyl-1-picryl hydrazyl (DPPH), butylated hydroxytoluene (BHT), d(+)-catechin, gallic acid, tannic acid, sodium carbonate, nitrobluetetrazolium (NBT), xanthine, xanthine oxidase, and Folin-Ciocalteu reagent, iron(III) chloride (FeCl₃), hydrogen peroxide (H₂O₂), ascorbic acid were all purchased from Sigma-Aldrich (St. Louis, MO, USA) or Merck & Co (Darmstadt, Germany). For in vitro studies, bovine serum albumin, Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), Dulbecco’s phosphate buffered saline (DPBS), penicillin, and streptomycin were purchased from Hyclone (Logan, UT, USA). Oligo primers were purchased from Macrogen (Seoul, Korea). For in vivo studies, silymarin, olive oil, CCl₄, Oil Red O, hematoxylin and eosin (H&E) stain, triethanolamide, 5,5’-dithiobis(2-nitrobenzoic acid) (DTNB), glutathione (GSH), superoxide dismutase (SOD), 2-thiobarbituric acid (TBA), and sodium azide were purchased from Sigma-Aldrich.