Total RNA was isolated using TRIzol reagents according to the instruction of the manufacturer (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed to cDNA using reverse transcription reagents kit (Takara, Dalian, China). Fifty nanograms of cDNA were used for real-time PCR. Primers for rat tau: forward primer 5′-GGGACATGGGTGATGTTATCCAA-3′, reverse primer 5′-CCTGAGCAAGGTGACCTCCAA-3′ β-actin: forward primer 5′-GGAGATTACTGCCCTGGCTCCTA-3′, reverse primer 5′-GACTCATCGTACTCCTGCTTGCTG-3′. The PCR cycle was as follows: 95 °C/30 s, 40 cycles of 95 °C/5 s, 60 °C/30 s and 72 °C/30 s, and the melt-curve analysis was performed following each experiment. The amplification and analysis were performed using a StepOnePlus Real-Time PCR Detection System (Thermo Fisher, New York, NY, USA). Samples were compared using the relative CT method.
Reverse transcription reagents kit
Manufactured by Takara Bio
Sourced in China
The Reverse Transcription Reagents Kit is a set of reagents designed for the conversion of RNA to cDNA. The kit includes all the essential components needed to perform reverse transcription, a fundamental step in various molecular biology applications, such as gene expression analysis and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
5 protocols using reverse transcription reagents kit
1
Rat Tau Gene Expression Analysis
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The RNA was then reversely transcribed to cDNA using a reverse transcription reagents kit (Takara RR047A). The qPCR was performed on an ABI 7500 instrument (Life Technology, Grand Island, NY 14072) using a standard procedure. β-actin was selected as the housekeeping control gene. An amount of 100 ng cDNA was used for the qPCR kit (Takara RR820A). The relative mRNA abundance was measured by the difference in threshold values between the target gene and the housekeeping control gene, β-actin. The resulting threshold values represented an average of triplicates [28 (link)]. The primers used in the qPCR are shown (Table 1 ).
3
Osteogenic Potential of rBMSCs: Transcriptional Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The rBMSCs (5⨰104cells/well) were cultured in CM or standard medium for seven days, respectively. Then the expressions of osteogenesis-associated genes runt-related transcription factor 2 (RUNX2), type I collagen (COL1), osteocalcin (OCN), ALP were measured. The results were standardized according to the GAPDH expression, which was a housekeeping gene. Total RNA was extracted from rBMSCs with the RNeasy Mini Kit (Qiagen). The extracted RNA was reversely transcript to obtain cDNA with a reverse transcription reagents kit (Takara, Japan) following instructions of the manufacturer. Real-time PCR assay was conducted with the Maxima SYBR-ⅠGreen/ROX qPCR (Thermo Scientific) on a Rocha-LightCycler 96 (ABI7500 fast, Singapore). Gene expressions were calculated according to the method of 2−ΔΔCt. The sequences of the primers and the genes selected in this experiment are list in Table 2
Primers sequences
| Gene | Forward Primer Sequence (5–3) | Reverse Primer Sequence (5–3) |
|---|---|---|
| RUNX2 | CGGACGAGGCAAGAGTTTCA | GGATGAGGAATGCGCCCTAA |
| COL1 | GCAGACTGGCAACCTCAAGA | CAGGGCCAATGTCTAGTCCG |
| OCN | TAGTGAACAGACTCCGGCGCTA | TGTAGGCGGTCTTCAAGCCAT |
| Alp | TCATTCCCACGTTTTCACATTC | GTTGTTGTGAGCGTAATCTACC |
| GAPDH | ATCCCATCACCATCTTCC | GAGTCCTTCCACGATACCA |
4
Quantifying ADAM10 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cortex RNA was extracted using TRIzol reagents according to the instructions (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed to cDNA using reverse transcription reagents kit (Takara, Dalian, China). Fifty nanograms of cDNA were used for real-time PCR. Primers for ADAM10 were 5’-CTGGCCAACCTATTTGTGGAA-3’ and 5’-GACCTTGACTTGGACTGCACTG-3’, and primers for GAPDH were 5’-AACGACCCCTTCATTGAC-3’ and 5’- TCCACGACATACTCAGCAC -3’, respectively. The parameters of PCR cycle were 95° C/10 min, and 40 cycles of 95° C/10 s, 60° C/30 s, and 72° C/30 s. The amplification and analysis were performed using a StepOne Plus Real-Time PCR Detection System (Life Technologies, Grand Island, NY, USA). Samples were compared using the relative CT method.
5
Real-Time PCR Analysis of Peripheral Nerve Regeneration Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Firstly, the collecting sciatic nerves were homogenized in TRIzol reagent. Then, total RNA was reverse-transcribed into cDNA using Reverse Transcription Reagents Kit (TaKaRa, RR037A). The real-time PCR was conducted in a 7900HT Fast Real-Time PCR System using SYBR Green PCR Master Mix (Bio-Rad, Hercules, CA, USA). Lastly, the results were expressed as 2^(–ΔΔCt). The primer sequence of Egr2, MBP, MPZ, Pmp22, and Sox10 genes for real-time PCR were listed in Table 1 .
Primers used for RT-PCR in this study.
| Gene | Prime sequence | Product size (bp) | Serial number |
|---|---|---|---|
| β-actin | F: GCAAGTGCTTCTAGGCGGACTG | 195 | NM_001101683.1 |
| R: CTGCTGTCACCTTCACCGTTCC | |||
| MBP | F: AGTCCGACGAGCTACAGACCATC | 106 | XM_017338987.1 |
| R: TACTTGGAGCCGTGCCTCTGG | |||
| MPZ | F: TCATCGAGATGGAGCTACGGAAGG | 89 | XM_008264187.2 |
| R: GGCGTTCTTGAGGCTGGTTCTG | |||
| Erg 2 | F: GTGGGGAGCGAGAACAATTA | 87 | XM_017338174.1 |
| R: GTTGTCGGTGAATTGGACCT | |||
| Pmp 22 | F: AGAGACAGCCATAAGGAGAACG | 96 | XM_017343068.1 |
| R: TGCAGACCACACCCTTCAT | |||
| Sox 10 | F: TCCAAAAACTAATCACAACAATCG | 141 | XM_008266894.2 |
| R: GAAGTGCAATTGGGATGAAAA |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!