E coli bl21

Plasmids obtained from the recombinant DNA library were transformed into competent E. coli BL21* (New England Biolabs, Ipswich, MA) for expression as described in [56 (link)]. Briefly, transformants were cultured in a 1 L hyper-broth media (Sigma-Aldrich, Natick, MA, USA) containing a yeast extract medium 25 g/L and a 15% glucose nutrient mix as well as ampicillin (100 µg/mL) at 37 °C under aeration conditions until cultures reached the mid logarithmic growth phase (OD600 = 0.5–0.8); protein expression was induced by the addition of 1 mM Isopropyl-β-d-thiogalactopyranoside (IPTG) (Sigma-Aldrich). After 6 h, the culture was centrifuged at 7500× g for 20 min, and the resulting pellet was collected and stored at −20 °C. The pellet was lysed in 8 M urea pH = 8.0 overnight after which Nickel-NTA beads (Qiagen, Hilden, Germany) were added. Protein column purification was performed using urea buffered at decreasing pH intervals = 8.0, 6.3, 5.9, 4.5 with the targeted protein being eluted at pH 4.5. The resulting elutants were run on an SDS-PAGE. The aliquots containing the target proteins were prepared for dialysis in 50 mM phosphate buffer at pH 5.4, and finally, water to remove the urea and induce proper folding of the proteins. The resulting solution was then lyophilized to obtain the pure protein in solid form.

His-tagged nanobody and Folding reporter GFP [55 (link)] under control of the T7 promoter were produced in E. coli SHuffle (New England Biolabs) and E. coli BL21 (DE3), respectively, by induction with 0.4 mM IPTG for 5 h. Cells were then resuspended in IMAC wash buffer (50 mM Tris–HCl, 10 mM imidazole, 500 mM NaCl, 10 % glycerol [pH 7.5]), lysed by three passes through an EmulsiFlex-C5 homogenizer (Avestin) at 10,000–15,000 psi and any debris and unbroken cells were removed by centrifuging at 18,000g at 4 °C for 15 min. The supernatant containing the proteins of interest was loaded onto nickel-nitrilotriacetic acid (Ni²⁺-NTA) resin columns (HisTRAP) on an Äkta Pure system connected to an F9-C fraction collector (GE). The bound protein was washed extensively with IMAC wash buffer and was subsequently eluted by increasing the imidazole concentrations to 500 mM in a single step. The fractions containing the protein of interest were pooled and stored at –80 °C for nanobody, and –20 °C for GFP, until use.

The gene encoding 25-HSK (SDENChol_21286) was amplified with a C-terminal Strep-tag by PCR from S. denitrificans genomic DNA as the template using the following primers: 21286_for (GTCATGGCTAGCATGTCTGATACACCGGATCTG) and 21286_rev (CTAGTCAAGCTTTTACTTTTCGAACTGCGGGTGGCTCCATCCTCCGAAATCCCAGGGATCTTCGC). The resulting 1.2 kb DNA fragment was NheI/HindIII double digested, cloned into pASK-IBA15plus, and transformed into E. coli BL21 according to protocols from New England Biolabs (NEB). Induction of 25-HSK was carried out in 2× YT medium (18 g L⁻¹ tryptone, 10 g L⁻¹ yeast extracts, and 5 g L⁻¹ NaCl) supplemented with 100 μg ml⁻¹ ampicillin. When optical density at 600 nm reached values above 0.5, 20 μg ml⁻¹ anhydrotetracycline (AHT) was added. Induction was carried out at 20 °C while shaking at 180 rpm. Cells were harvested in the late exponential phase (>16 h induction) by centrifugation (8000g, 20 min, and 4 °C), and frozen in liquid nitrogen.

The pCas10/Csm plasmid was provided by Dr Zhiwei Huang from Harbin Institute of Technology and was used to make each subunit of Csm complexes into pET28a (pET28a-Cas10, pET28a-Csm2, pET28a-Csm3, pET28a-Csm4 and pET28a-Csm5) with kanamycin resistance. Each recombinant plasmid was transfected into E. coli BL21 (New England Biolabs, Ipswich, MA). E. coli BL21 with pET28a-Cas10 strain, E. coli BL21 with pET28a-Csm2 strain, E. coli BL21 with pET28a-Csm3 strain, E. coli BL21 with pET28a-Csm4 strain, and E. coli BL21 with pET28a-Csm5 strain were cultured at 28°C, induced by IPTG to express each subunit of Csm complexes, and purified by using Ni²⁺-NTA resin. Briefly, E. coli BL21 containing the recombinant plasmid was cultured in LB media with OD₆₀₀ = 0.5 and then induced with 0.5 mM IPTG for 8 h at 28°C. Cells were lysed by sonication in a lysis buffer (Phosphate Buffered Saline, pH 7.2, two complete EDTA-free protease inhibitor tablets, 1 mM phenylmethyl-sulfonyl fluoride). Cell debris was removed by centrifugation at 15 000 g/min for 10 min at 4°C. His-tagged proteins were purified using Ni²⁺-NTA resin (Thermo Fisher Scientific, Rockford, IL) according to the manufacturer's instructions. After dialysis, the proteins were concentrated through Pierce^TM Protein Concentrator PES-3K MWCO (Thermo Fisher Scientific, Waltham, MA) and detected by SDS-PAGE gels.

pMAL constructs were expressed as N-terminus MBP fusion proteins carrying a C-terminal His tag and selected on medium containing ampicillin (200 μg/ml final concentration). pET28b+ constructs were expressed as N-terminus His tagged enzymes and selected on kanamycin (30 μg/ml final concentration). The pLgals1 construct is the fusion of an N-terminal human galectin-1 with hST3gal1 and was selected with 100 μg/ml ampicillin. Plasmids were transformed for expression in E. coli BL21 (New England BioLabs), SHuffle T7 Express (New England BioLabs) and Origami 2 DE3 (Novagen, Darmstadt, Germany) and plated onto LB agar plates containing the appropriate antibiotic. Tetracycline (12.5 μg/ml final concentration) was also included for selection of the gor mutation in Origami. One colony was used to inoculate 5 mL LB medium and overnight cultures were used to inoculate 500 mL LB broth. Cultures were grown at 30°C and 200 rpm shaking until an OD₆₀₀ of 0.55–0.65 was reached. Temperature was dropped to 17°C for expression of hST3Gal1 and hST6Gal1. Sialyltransferase expression was induced by adding IPTG to a final concentration of 0.1 mm. Cultures were incubated over 22 hours and cells harvested by centrifugation (6500 x g, 15 min) and washed. Pellets were resuspended in 7 mL lysis buffer (25 mm NaH₂PO₄, 25 mm Na₂HPO₄, 300 mm NaCl and 20 mm imidazole, pH 8) and frozen at -20°C.