Blood total rna rapid extraction kit

Total RNA from tissues (50 mg) was isolated by Trizol Reagent (TaKaRa, Tokyo, Japan) and plasma samples (200 μL) were isolated using the Blood Total RNA Rapid Extraction Kit (BioTeke, China). Total RNAs were then reverse transcribed using a PrimeScriptRT Reagent Kit with gDNA Eraser (TaKaRa) following the manufacturer's protocol. HOTAIR expression was measured by real time‐polymerase chain reaction (RT‐PCR) using SYBR Green assays (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). β‐actin was used to normalize the relative levels of lncRNA. Primers were designed with Primer 5, synthesized by Sangon Biotech (Shanghai, China), and sequenced as follows: 5′‐GGTAGAAAAAGCAACCACGAAGC‐3′(forward) and 5′‐GCACGAAGGCTCA TCATTCA‐3′ (reverse) for HOTAIR;5′‐TCCTCTCCCAAGCCACACA‐3′ (forward) and 5′‐GCACGAAGGCTCATCATTCA‐3′ (reverse) for β‐actin. The relative expression was calculated using 2 − ΔΔCt methods.10

Total RNA was extracted from BC tissues and cells using Trizol Reagent (Takara, Tokyo, Japan). Total RNA in plasma was extracted using a Blood Total RNA Rapid Extraction Kit (BioTeke Corporation, Beijing, China). The reverse transcription (RT) reaction was conducted using a PrimeScript RT reagent Kit with gDNA Eraser (Takara), according to the manufacturer's instructions. RT reactions were performed at 42°C for two minutes, 37°C for 15 minutes, 85°C for five seconds, and 4°C for 10 minutes. LincRNA‐ROR expression levels were detected by real‐time PCR using SYBR Premix Ex Taq II (Takara) in a 7500 Fast Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). The PCR conditions consisted of an initial polymerase activation step at 95°C for 30 seconds, 40 cycles of 95°C for five seconds, and 60°C for 30 seconds, followed by a dissociation cycle of 95°C for 15 seconds, 60°C for 60 seconds, 95°C for 15 seconds, and 60°C for 15 seconds. The relative expression levels of lincRNA‐ROR were normalized by β‐actin. The sequences of lincRNA‐ROR and β‐actin were as follows: lincRNA‐ROR: 5′‐CTCAGTGGGGAAGACTCCAG‐3′ (forward), 5′‐AGGAAGCCTGAGAGTTGGC‐3′ (reverse); β‐actin: 5′‐TCCTCTCCCAAGTCCACACA‐3′ (forward), 5′‐GCACGAAGGCTCATCATTCA‐3′ (reverse). Each reaction was performed in triplicate. The 2^−ΔΔCT method was used to calculate relative expression levels.18