Log In Sign up
The largest database of trusted experimental protocols

Phusion site directed mutagenesis

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Phusion Site-Directed Mutagenesis kit is a tool for introducing specific modifications into DNA sequences. It enables precise, site-directed changes to be made to plasmid or other DNA, allowing researchers to study the effects of targeted mutations.

Automatically generated - may contain errors

Lab products found in correlation

Glutathione sepharose 4b, by GE Healthcare (2 mentions) Reduced glutathione, by Merck Group (2 mentions) Pgex 4t 1, by GE Healthcare (1 mentions) Nanodrop photospectrometer, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Phusion site-directed mutagenesis protocol Phusion Site-Directed Mutagenesis Kit Phusion site-directed mutagenesis kit protocol Site-directed mutagenesis Phusion mutagenesis

12 protocols using phusion site directed mutagenesis

1

Recombinant Protein Purification and SETD3 Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
SETD3 (Q86TU7), actin (ACTB, P60709), and CV-B3 2AC107A (GenBank: M33854.1) were cloned into pGEX-6P-1. Truncated SETD3 constructs were generated using Phusion Site-Directed mutagenesis (Thermo Scientific) according to manufacturer’s recommendations. All proteins were expressed as N-terminal GST fusions in BL21 bacteria. Expression was performed at 20°C overnight in the presence of 0.1 mM IPTG. Recombinant proteins were purified with Glutathione sepharose 4B (GE Healthcare) and eluted with 10 mg/ml reduced glutathione (Sigma-Aldrich), 100 mM Tris pH 8.0, and 20% glycerol. In vitro methyltransferase reactions were performed with 5 μg SETD3, 1 μg substrate, and 2 μCi 3H-S-adenosylmethionine in a buffer containing 50 mM Tris pH 8.0, 20 mM KCl, 5 mM MgCl2 at 30°C overnight. Reactions were resolved by SDS-PAGE and 3H-methylation was visualized by autoradiography and gels were stained with Coomassie.
Diep J., Ooi Y.S., Wilkinson A.W., Peters C.E., Foy E., Johnson J.R., Zengel J., Ding S., Weng K.F., Laufman O., Jang G., Xu J., Young T., Verschueren E., Kobluk K.J., Elias J.E., Sarnow P., Greenberg H.B., Hüttenhain R., Nagamine C.M., Andino R., Krogan N.J., Gozani O, & Carette J.E. (2019). Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3. Nature microbiology, 4(12), 2523-2537.
+ Open protocol
+ Expand
2

Expression and Purification of GAP Domains

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression vector for MgcRacGAP GAP domain was constructed by ligating the cDNA corresponding to codons for residues 345-618 of human MgcRacGAP (NCBI accession no. NM_013277) between the EcoR I and Xho I restriction sites of pGEX-4T-1 (GE Healthcare). Expression vectors for BCR GAP domain (residues 1010-1271 of human BCR (NP_004318)), p50RhoGAP GAP domain (residues 205-439 of mouse p50RhoGAP (NP_001139374)), PAK1 PBD domain (residues 72-132 of human PAK1 (AAC50590) and Rac1 Q61L (NP_008839) were analogous to constructs that have been described previously [34 (link), 35 (link)]. The F28L variant of human Rac1 was produced by PCR-based Phusion Site-Directed Mutagenesis (Thermo Scientific) and subcloned into the bacterial expression vector pGEX-4T-1 [35 (link)]. All DNA constructs were confirmed by DNA sequencing.
E. coli DH5α were transformed with the pGEX constructs, and recombinant proteins were purified as described by García-Mata et al. [36 (link)]. Protein concentrations were determined using a NanoDrop photospectrometer (Thermo Scientific) and Bradford protein assay, while protein purities were analyzed by SDS-PAGE and Coomassie Blue staining.
van Adrichem A.J., Fagerholm A., Turunen L., Lehto A., Saarela J., Koskinen A., Repasky G.A, & Wennerberg K. (2015). Discovery of MINC1, a GTPase-Activating Protein Small Molecule Inhibitor, Targeting MgcRacGAP. Combinatorial Chemistry & High Throughput Screening, 18(1), 3-17.
+ Open protocol
+ Expand
3

STAT3 Tyr705 Deletion Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Phusion Site-Directed Mutagenesis (Thermo Scientific) was used to create STAT3 Tyr705 deletion mutants. Primers used create the STAT3 Y705 deletion mutation are: 5′ CTGAAGACCAAGTTTATCTGTGTG ACACCAAC and 5′ TGGGGCAGCGCTACCTGG.
McCann G.A., Naidu S., Rath K.S., Bid H.K., Tierney B.J., Suarez A., Varadharaj S., Zhang J., Hideg K., Houghton P., Kuppusamy P., Cohn D.E, & Selvendiran K. (2014). Targeting constitutively-activated STAT3 in hypoxic ovarian cancer, using a novel STAT3 inhibitor. Oncoscience, 1(3), 216-228.
+ Open protocol
+ Expand
4

Plasmid Constructs for CBM Complex

Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression plasmids encoding cIAP2-MALT1 and cIAP2-MALT1 Cys464Ala were obtained from the BCCM/LMBP collection (#5537 and #5538). Human CBM components were encoded in a single expression plasmid-encoding FLAG-tagged MALT1 (NM_006785.3), BCL10 (NM_003921.4), and an active oncogenic mutant of CARD11 (Leu251Pro) (NM_032415.5). Expression constructs encoding candidate substrates with a C-termini myc and FLAG-tag (Supplementary Table 2) were from (Origene, GeneCopoeia, and GenScript). Noncleavable human TANK (Arg215Lys) was made using Phusion Site-Directed mutagenesis (Thermo Fisher Scientific); all other substrate P1-Arg to Ala cleavage-resistant constructs were generated using Quick-Change XL (Agilent Technologies) site-directed mutagenesis. Mutagenesis primers are listed in Supplementary Table 2. All DNA sequences were verified by Sanger sequencing.
Bell P.A., Scheuermann S., Renner F., Pan C.L., Lu H.Y., Turvey S.E., Bornancin F., Régnier C.H, & Overall C.M. (2022). Integrating knowledge of protein sequence with protein function for the prediction and validation of new MALT1 substrates. Computational and Structural Biotechnology Journal, 20, 4717-4732.
+ Open protocol
+ Expand
5

Subcloning FGFR2 Variants into RCAS Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNAs coding for FGFR2, FGFR2M391R, FGFR2Y381D, and NoLS-FGFR2 were subcloned from pCMV Tag4a vector (previously described in Neben et al., 2014 (link)) into the ClaI restriction site in the RCAS BP(A) vector using Sense and Antisense ClaI FGFR2 primers. To generate the cDNA coding for NLS-FGFR2, Phusion Site Directed Mutagenesis (Thermo Fisher Scientific) was used to insert the SV40 Large T antigen NLS between the signal peptide and the first Ig domain of FGFR2 using the NLS Insertion Forward and NLS Vector Reverse primers. NLS-FGFR2 was then subcloned from pCMV Tag4a vector into the ClaI site of RCAS BP(A) vector. Sequence of clones were verified via Sanger sequencing. All primers are found in Supplemental Table 1.
Salva J.E., Roberts R.R., Stucky T.S, & Merrill A.E. (2019). Nuclear FGFR2 regulates musculoskeletal integration within the developing limb. Developmental dynamics : an official publication of the American Association of Anatomists, 248(3), 233-246.
+ Open protocol
+ Expand
6

Bacterial Expression and Purification of ADH Slow Allele

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ADH Slow allele coding sequence, which contains a Lys192 codon (K192), was synthesized with codon bias optimized for bacterial expression (GenScript). An identical sequence but containing Thr192 codon (T192) was generated from the Slow template by Phusion Site-Directed Mutagenesis (ThermoFisher). Sequences were cloned into pLIC-(His6)maltose binding protein fusion plasmids, verified by Sanger sequencing, and transformed into Escherichia coli BL21 (DE3) Rosetta. Protein was expressed and purified from transformed cells using nickel-affinity and column chromatography (detailed in SI Appendix).
Siddiq M.A, & Thornton J.W. (2019). Fitness effects but no temperature-mediated balancing selection at the polymorphic Adh gene of Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United States of America, 116(43), 21634-21640.
+ Open protocol
+ Expand
7

Generating Caspase-6 Variant Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The caspase-6 variants, full length wild type (FL WT), FL C163S and constitutively two-chain (CT) were derived from the synthetic, E. coli codon-optimized (His)6 C-terminally tagged caspase-6 gene (Celtek Bioscience) that were ligated into the NdeI/BamHI sites of pET11a vector.31 (link) Selected caspase-6 tumor-associated variants were generated using FL WT as template through Phusion® site-directed mutagenesis (Thermo Scientific™). The caspase-6 R259H CT and W227A CT variants were particularly generated using caspase-6 D179CT as the template for the site-directed mutagenesis.
Dagbay K.B., Hill M.E., Barrett E, & Hardy J.A. (2017). Tumor-Associated Mutations in Caspase-6 Negatively Impact Catalytic Efficiency. Biochemistry, 56(34), 4568-4577.
+ Open protocol
+ Expand
8

Stabilizing Caspase-9 Dimer Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Caspase-9 exists primarily as a monomer in solution, as seen by SEC (Huber and Hardy, 2012 (link)). A constitutively dimeric caspase-9 has been reported, which decreases the distribution of caspase-9 monomers in solution and increases the more biologically relevant dimer (Chao et al., 2005 ). In this dimeric caspase-9, 5 residues at the dimer interface of caspase-9 were replaced with the residues from caspase-3. We followed this strategy, and replaced the codons for residues 402-406 to the caspase-3 equivalent C-I-V-S-M on the C-terminus of caspase-9 C287A using Phusion site directed mutagenesis (Thermo Scientific).
Eron S.J., Raghupathi K, & Hardy J.A. (2016). Dual Site Phosphorylation of Caspase-7 by PAK2 Blocks Apoptotic Activity by Two Distinct Mechanisms. Structure (London, England : 1993), 25(1), 27-39.
+ Open protocol
+ Expand
9

Recombinant Protein Purification and SETD3 Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
SETD3 (Q86TU7), actin (ACTB, P60709), and CV-B3 2AC107A (GenBank: M33854.1) were cloned into pGEX-6P-1. Truncated SETD3 constructs were generated using Phusion Site-Directed mutagenesis (Thermo Scientific) according to manufacturer’s recommendations. All proteins were expressed as N-terminal GST fusions in BL21 bacteria. Expression was performed at 20°C overnight in the presence of 0.1 mM IPTG. Recombinant proteins were purified with Glutathione sepharose 4B (GE Healthcare) and eluted with 10 mg/ml reduced glutathione (Sigma-Aldrich), 100 mM Tris pH 8.0, and 20% glycerol. In vitro methyltransferase reactions were performed with 5 μg SETD3, 1 μg substrate, and 2 μCi 3H-S-adenosylmethionine in a buffer containing 50 mM Tris pH 8.0, 20 mM KCl, 5 mM MgCl2 at 30°C overnight. Reactions were resolved by SDS-PAGE and 3H-methylation was visualized by autoradiography and gels were stained with Coomassie.
Diep J., Ooi Y.S., Wilkinson A.W., Peters C.E., Foy E., Johnson J.R., Zengel J., Ding S., Weng K.F., Laufman O., Jang G., Xu J., Young T., Verschueren E., Kobluk K.J., Elias J.E., Sarnow P., Greenberg H.B., Hüttenhain R., Nagamine C.M., Andino R., Krogan N.J., Gozani O, & Carette J.E. (2019). Enterovirus Pathogenesis Requires the Host Methyltransferase SETD3. Nature microbiology, 4(12), 2523-2537.
+ Open protocol
+ Expand
10

Caspase-6 Variants and Constructs

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length wild-type (FL WT) caspase-6 used in this study was derived from a synthetic, Escherichia coli codon-optimized (His)6 C-terminally tagged caspase-6 gene (Celtek Bioscience) that was ligated into the NdeI/BamHI sites of the pET11a vector. Caspase-6 variants (C163S, Y198A, and C163S/Y198A) as well as the N-terminally (His)6 tagged FL caspase-6 were generated using Phusion site-directed mutagenesis (Thermo Scientific) in the FL WT caspase-6 construct. Fully cleaved and active caspase-6 was also used in the form of a constitutive two chain (CT), which was designed to independently express the large and small subunits of caspase-6 with the prodomain (residues 1–23) and linker (residues 180–193) removed.9 (link)
Okerberg E.S., Dagbay K.B., Green J.L., Soni I., Aban A., Nomanbhoy T.K., Savinov S.N., Hardy J.A, & Kozarich J.W. (2019). Chemoproteomics Using Nucleotide Acyl Phosphates Reveals an ATP Binding Site at the Dimer Interface of Procaspase‑6. Biochemistry, 58(52), 5320-5328.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!