Plko 1 puro vector

CYBA (gene encoding p22phox) knockdown was performed by lentiviral transduction of shRNA as previously described.^{31 (link), 32 (link)} Briefly, lentiviral shRNA constructs in the pLKO.1 Puro vector (Open Biosystems, Thermo Fisher Scientific) were ordered. Targets (sense) used for these studies were scrambled control (Ctrl) 5’- GTCTCCGAACGTGT CACGTT-3’ and CYBA (TRCN0000064581) 5’-CGCTTCACCCAGTGGTACTTT-3’. 3.5×10⁶ HEK293T cells, which were used to generate viral particles, were plated on a tissue culture treated 10cm dish the day before transfection. One 10cm plate was transfected per shRNA construct by the calcium phosphate method using the following constructs: 6 μg control or CYBA shRNA construct, 0.6 μg vesicular stomatitis virus (VSV-G), and 5.4 μg cytomegalovirus (CMV 8.9.1). Supernatant was collected after 72 hr. and centrifuged to remove debris. 1×10⁶ PLB-985 were mixed with the viral supernatant in the presence of 4 μg/ml polybrene in a 6 well plate and centrifuged at 1000× g in a swinging bucket centrifuge for 30 minutes at 32°C. Stable lines were created by selection of transduced cells with 1 μg/ml puromycin.

Stable cells with decreased expression of ZnT1 (SLC30A1) and ZnT4 (SLC30A4) were generated by lentivirus-mediated shRNA expression. The pLKO.1-Puro vector expressing shRNA sequences targeting ZnT1 (target sequence of 3 clones: CCTGCAAAGCATTTGTAGAAA, GCTACTACCATTCAGCCTGAA, and GAAGTACAAGTGAATGGAAAT), and ZnT4 (target sequence of 3 clones: CATACGATTCAAGCCAGAATA, CATAGTTCACATACAGCTAAT, and TATGGGATACAGTAGTTATAA) were obtained from OpenBiosystems, and viruses were generated at the Department of Urology of the UT Southwestern Medical Center. Polyclonal pooled populations of stable cells were selected in the presence of puromycin (2 μg/ml) for more than 3 passages before initiating any functional experiments. Western blot was performed for evaluate the knockdown efficiency of shZnT1 and shZnT4 (Figure S1).