Bis acrylamide

The affinity binding between the ZNF or mutants of CTCF and DNA was measured by gel mobility shift assays. 1 pmol of each of the purified proteins were incubated with 0.5 pmol of the ³²P-labeled duplex oligonucleotide (CCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAG) in HEPEs buffer (25 mM HEPES pH 8.0, 50 mM KCl, 50 mM MgCl₂, 1% NP40, 10% glycerol and 200 ng poly (dI/dC)) for 20 min at 4 °C. The samples were analyzed with 7.5% polyacrylamide gel (Acrylamide: Bis-Acrylamide 29:1, 40% Solution, Thermo Fisher Scientific).

Acrylamide monomer, bis-acrylamide (a cross-linker agent), creatinine powder (99+%), N-hydroxysuccinimide (NHS, 98+%), Tetramethylethylendiamine (TEMED) and ammonium persulfate (APS) were purchased from Fisher Scientific, Waltham, MA, USA. Fluorescent nanodiamond (70 nm average particle size, 1 mg/mL in deionized (DI) water with >300 nitrogen-vacancy centers per particle) was purchased from Sigma-Aldrich (St. Louis, MO, USA).

Fibronectin-coated (5 μg/ml, BD Biosciences, Franklin, Lakes, NJ, USA) polyacrylamide gels were prepared on glass slides (Fisher, Waltham, MA, USA) as previously described22 (link). Two ratios of acrylamide to bis-acrylamide (Fisher), 50:1 and 12.5:1, were used to make gels with Young’s moduli of 1 kPa and 308 kPa, respectively. The Young’s moduli of the polyacrylamide gels were measured using a rheometer as previously described22 (link).

To determine the distribution of nascent leading-strand initiation sites, deproteinized replication products from chromatin reactions were cleaved with the restriction enzymes XbaI, NotI, SacI, PsiI, EcoRV or BsaBI (NEB) in Cut Smart buffer, for 30 minutes at 37°C. Digests were stopped by adding EDTA to final concentration of 50 mM, followed by deprotinization with proteinase K - SDS treatment and phenol-chloroform extraction as described above. Sample aliquots were analyzed on 1% alkaline and 0.8% native agarose gels, where required. The remaining digested products were ethanol precipitated, washed with 70% ethanol, air-dried and resuspended in 10 mM Tris-HCl, pH 8; 1 mM EDTA. For the RNase HII experiments, digestion products were further treated with RNase HII enzyme (NEB) for 1 hour at 37°C. The reactions were stopped with 50 mM EDTA and processed as described above for the restriction digests. For polyacrylamide gel analysis an equal volume of 2x loading dye (80% formamide; 0.05% SDS; 10 mM EDTA; 100 mM NaCl; 0.04% xylene cyanol; 0.04% bromophenol blue) was added to the samples. Samples were incubated for 3 minutes at 95°C, promptly transferred to ice, before being applied to a 40 cm x 20 cm denaturing 4% polyacrylamide (Bis-Acrylamide 19:1 – Fisher scientific), 7 M Urea, in 1x Tris-Borate-EDTA buffer (TBE) gel. Gels were run for 170 minutes at constant 40 Watt.