The human HSDL2-specific targeting sequence (5′-CCA GAA GCA GTT AGC AAG AAA-3′) and a scrambled shRNA (5′-TTC TCC GAA CGT GTC ACG T-3′) were designed at GeneChem (Shanghai, China). HSDL2 or scrambled hairpin oligonucleotides were subcloned into pGCSIL-GFP lentiviral vector (GeneChem) and named as shHSDL2 and shCtrl, respectively. T24 and 5637 cells were seeded in 6-well plates and cultured for 48 h. Then, the cells were incubated with lentivirus shHSDL2 or shCtrl (MOI = 5) for 72 h, the efficiency of infection was calculated by evaluating GFP expression under fluorescence microscope (XI71, Olympus, Tokyo, Japan), and cells were collected for further analysis.
Scrambled shrna
Manufactured by Genechem
Sourced in China
Scrambled shRNA is a laboratory tool used to generate a non-targeting control shRNA sequence. It is designed to have no known targets in the genome, allowing it to serve as a control for shRNA knockdown experiments.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Lentiviral vector, by Genechem (2 mentions)
Puromycin, by Merck Group (2 mentions)
Pgcsil gfp lentiviral vector, by Genechem (1 mentions)
Scrambled shrna, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Srt1720, by MedChemExpress (1 mentions)
Matrigel matrix solution, by BD (1 mentions)
Dmem f12, by Thermo Fisher Scientific (1 mentions)
Lentivirus, by Genechem (1 mentions)
Ku55933, by Selleck Chemicals (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Sw620, by Shanghai Cell Bank (1 mentions)
Hct116, by Shanghai Cell Bank (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Nutrient mixture f 12 dmem f 12, by Thermo Fisher Scientific (1 mentions)
Trypsin ethylenediaminetetraacetic acid, by Thermo Fisher Scientific (1 mentions)
16 protocols using scrambled shrna
1
Lentiviral-mediated HSDL2 Knockdown
2
Inducing Lung Fibrosis in Mice via shRNA Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three different mouse LTBP2 shRNAs and scrambled shRNA were designed and synthesized by GeneChem (Shanghai, P.R. China). The target sequences of shRNAs are shown in Supplementary Table S1 . The shRNA1 with the best silencing efficiency was chosen for further animal experiments. C57BL/6 mice under anesthesia were intratracheally administrated with scrambled shRNA or LTBP2 shRNA at a dose of 3.5 × 107 transduction units per mouse. Five days later, mice were challenged with BLM for lung fibrosis experiments.
3
Silencing SIRT1 in HL-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids for SIRT1 shRNA (sh-SIRT1) and scrambled shRNA were obtained from GeneChem, and their sequences are shown in Table 2 . HL-1 cells were transfected with shRNA plasmids using Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA) lipid reagent, following the manufacturer’s instructions. Twenty-four hours after the shRNA transfection, the cells were treated as described in Section 2.6 . The shRNA sequences are shown in Table 2 .Table 2
Sequences of sh-SIRT1 and sh-NC mRNA.
| Name | shRNA sequence |
|---|---|
| sh-SIRT1 | ACCGGGATGCTGTGAAGTTACTGCTACTCGAGTAGCAGTAACTTCACAGCATCTTTTTTGAATTC |
| sh-NC | ACCGGCCTAAGGTTAAGTCGCCCTCGCTGAGCGAGGGCGACTTAACCTTAGGTTTTTGAATTC |
4
Stable Dectin-1 Silencing in THP-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The design of the Dectin-1 shRNA (interference sequence, 5'-CAATTACAC TTCGACTCTCAA-3'), a scrambled shRNA (5'-TTCTCCGA ACGTGTCACGT-3') and the packaging of the lentivirus particles were performed by Shanghai GeneChem Co., Ltd. A total of 4x104 THP-1 cells were cultured in supplemented RPMI medium in 96-well plates for 24 h. Subsequently, 4 µl HitransG P (25X; Shanghai GeneChem Co., Ltd.) enhanced infection solution was added prior to cell transduction with lentiviral particles at a multiplicity of infection (MOI) of 50 (virus number/cell number =50). Cells were incubated for 12 h, and then the culture medium was replaced with fresh medium. GFP expression was observed by fluorescence microscopy 72 h after transduction. After 72 h of infection, fresh medium containing 2 µg/ml puromycin was added for 72 h to select positively stably transduced cells. Stably transduced cells were maintained in 1 µg/ml puromycin. The third passage of stable clones was collected at 9 days after transduction for reverse transcription (RT)-qPCR analysis.
5
Lentiviral Transduction of IDH3A in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
UCC and LUAD cells (1 × 105) were infected at a multiplicity of infection (MOI) of 20 with scrambled-shRNA, IDH3A-shRNA, vector, or IDH3A-overexpressing lentiviruses (GeneChem, Shanghai, China) for 48 h at 37 °C in the presence of 5 μg/mL of polybrene. The expression of IDH3α in transduced cells was validated by qPCR and WB.
6
Knockdown of MSLN in SKOV-3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Knockdown of MSLN in the SKOV-3 cells and the mock vector control cells were generated through shRNA lentiviral vectors with two shMSLN and scrambled shRNA (Genechem, China), respectively, according to the manufacturer’s instructions. The lentiviral vectors and polybrene were added into the medium when the cells grew up to 30–40% confluence. 12 h later, fresh medium was replaced; then, transfected cells were selected with puromycin. The knockdown effect was verified by Western blotting and the cells were used for further experiments.
7
Knockdown of CCT8 by shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA plasmid specific for CCT8, scrambled shRNA, and lentiviral vector were purchased from GeneChem (GeneChem, Shanghai, China). Stable transfection with lentiviral vector was performed in accordance with manufacturer’s protocols. scrambled shRNA was used as control.
8
REST Knockdown Using Lentiviral shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA plasmid specific for REST, scrambled shRNA, and lentiviral vector were purchased from GeneChem (GeneChem, Shanghai, China). Stable transfection with lentiviral vector was performed in accordance with manufacturer's protocols. scrambled shRNA was used as control.
9
Podocyte Knockdown Assay for HG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gp91phox shRNA and TXNIP shRNA were purchased from Genechem (Shanghai, China); meanwhile the scrambled shRNA (Genechem, Shanghai, China) was used as a control. Podocytes were transiently transfected with gp91phox/TXNIP shRNA or scrambled shRNA by lipofectamine 2000 (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instruction. Two days later, the podocytes were exposed to HG (30 mmol/L) for indicated times.
10
Placental Villous Tissue Explant Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The placental villous tissues were dissected into explants of 2–5 mm in diameter and explanted as previously described (Chen et al., 2018 (link); Zhang et al., 2012 (link)). A 24‐well plate was precoated with 50 μl of a 1 mg/ml Matrigel matrix solution (CA# 354234, BD Biosciences, San Jose, CA, USA) and incubated at 37°C for 4 h for solidification. Serum‐free DMEM/F12 (Gibco) medium containing 10% FBS (PAN) with 20 mM NAM (#HY‐B0150, MedChemExpress, USA), 3 μM SRT1720 (#HY‐10532, MedChemExpress, USA), 500 nmol/l lentiviral vector‐based shRNA targeting SIRT1 or an equal concentration of scrambled shRNA (GeneChem, Shanghai, China) was added to the wells; the explants were cultured in 3% oxygen and 5% CO2 for 48 h. The explants with good attachment and outgrowth on the gel were assessed after 24 and 48 h, respectively. The evaluation of villus outgrowth was performed as previously described (Li et al., 2014 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!