The largest database of trusted experimental protocols

Invitrogen lipofectamine 2000 reagent

Manufactured by Thermo Fisher Scientific
Sourced in United States, China

Invitrogen Lipofectamine 2000 reagent is a cationic lipid-based transfection reagent used for the delivery of genetic material, such as DNA, RNA, or siRNA, into eukaryotic cells. It forms complexes with the genetic material and facilitates their uptake by the cells.

Automatically generated - may contain errors

6 protocols using invitrogen lipofectamine 2000 reagent

1

PRPS1 Knockdown Using Lentiviral Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To stimulate down-regulation of PRPS1, the lentiviral constructs pLK0.1-puro-PRPS1si (1#/2#) and negative control (pLK0.1-puro-GFPsi) were used in knockdown experiments. The target sequences of these sites were:
PRPS1si-1#F: CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTTG;
PRPS1si-1#R: AATTCAAAAATGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCA;
PRPS1si-2#F: CCGGGAATCCGTTTCTTACCTATTCCTCGAGGAATAGGTAAGAAACGGATTCTTTTTG;
PRPS1si-2#R: AATTCAAAAAGAATCCGTTTCTTACCTATTCCTCGAGGAATAGGTAAGAAACGGATTC.
The lentiviral constructs were transfected into 293FT packaging cells using the Invitrogen® Lipofectamine® 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s protocol. Virus-containing supernatants were harvested and titred, and the lentivirus was then infected into target cells with 4 µg/mL Polybrene (Santa Cruz Biotechnology, Inc., Dallas, TX, USA). The transfected cells were selected with 2 µg/mL puromycin after the final round of infection (Thermo Fisher Scientific, Waltham, MA, USA) for three days. Drug-resistant cells were subsequently collected, expanded, and identified.
+ Open protocol
+ Expand
2

Transient transfection of miR-30c in DU145 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For transient transfection, 0.5×105 DU145 cells were plated in 24 well plates, 12 h prior to transfection. The pGCMV/EGFP/Neo vector (catalog no., C05001) with overexpression of miR-30c was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The blank vector was used as negative control. DU145 human prostate carcinoma cells were transiently transfected with mature miR-30c or control (miR-NC) using Invitrogen™ Lipofectamine 2000 reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Following the transfection of cells, BCL9 and several Wnt pathway downstream targets were detected by western blot analysis.
+ Open protocol
+ Expand
3

Prostate Cancer Cell Lines Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cell lines used in this study were purchased from the Shanghai Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, P.R. China). The cell lines included the DU-145, LNCap, and PC-3 human prostate cancer cell lines, as well as the RWPE-1 normal prostate epithelium cell line. All cell lines were cultured in RPMI-1640 medium (Takara Biotechnology Co., Ltd., Dalian, P.R. China) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA). Bovine pituitary extract (0.05 mg/ml; Thermo Fisher Scientific, Inc.) and human recombinant epidermal growth factor (5 ng/ml; Thermo Fisher Scientific, Inc.) were added to the culture medium of the RWPE-1 cells. The cell culture environment was thermostatic at 37°C with constant humidity and 5% CO2. The cells were mainly seeded into six-well plates at a density of 4 × 105 cells; a lower density was used depending on certain experiments. Once the cells reached 60–70% confluency, all transfections were performed with Invitrogen Lipofectamine® 2000 Reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions, with the synthesized RNA mimic or negative control (NC). Transfected cells were cultured for 48 or 72 h at the same conditions described above.
+ Open protocol
+ Expand
4

Ectopic Expression of CYLD via miR-186

Check if the same lab product or an alternative is used in the 5 most similar protocols
To induce the ectopic expression of CYLD, CYLD open reading frames containing a 3′-UTR was amplified by polymerase chain reaction (PCR) and then cloned into pGL3 vectors (Promega Corporation, Madison, WI, USA) downstream of the the Renilla luciferase complementary DNA. miR-186 mimic, miR-186 inhibitor, miR-186-mut and negative control (NC) were purchased from GeneCopoeia, Inc. (Guangzhou, China) and transfected into melanoma cells using Invitrogen Lipofectamine 2000 reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions.
+ Open protocol
+ Expand
5

Transfection and Imaging of EGFP-hTRESK in HEK293A Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human embryonal kidney (HEK) 293A cells (R705-07, Thermo Fisher Scientific) were transfected with 0.1 μg EGFP-hTRESK-iCtr or pEGFP-C1 control plasmid and 0.5 μl Invitrogen Lipofectamine 2000 reagent (Thermo Fisher Scientific) in 440 μl DMEM without FCS (Dulbecco′s Modified Eagle′s Medium, no Fetal Calf Serum) per well of ibidi μ-Slide 8-Well plates (ibidi Ltd) for 4 h. After the transfection, the cells were incubated in DMEM supplemented with 10% FCS, and examined next day. Living cells were imaged after replacing DMEM-FCS with a physiological salt solution containing (in mM): 138 NaCl, 4 KCl, 1 MgCl2, 1 CaCl2, 10 HEPES (pH 7.4 with NaOH). Images were captured with a Nikon A1plus, Ti2 Eclipse confocal microscope, by using the 488 nm laser for excitation, 60× oil immersion objective, and NIS-Elements software 5.11.
+ Open protocol
+ Expand
6

Knockdown of TLR4 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were transfected with various siRNA directed against TLR4 (catalog nos.: siRNA1, TLR4-homo-1546; siRNA2, TLR4-homo-1325; siRNA3, TLR4-homo-595), and negative siRNA with a random sequence was used as a control (Shanghai GenePharma Co., Ltd., Shanghai, China). The siRNA sequences are shown in Table I. The cells were seeded at a density of 5×105 cells/well into 6-well dishes and cultured overnight at 37°C with 5% CO2 until the cells reached 70% confluency. The transfections were performed using Invitrogen Lipofectamine 2000 reagent (Thermo Fisher Scientific, Inc.), according to the manufacturers protocol.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!