The largest database of trusted experimental protocols

48 protocols using control rabbit igg

1

ChIP-qPCR protocol for FoxO1 transcription factor

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, ~10×106 cells were crosslinked with 1% formaldehyde and quenched with 0.125M glycine as previously described (Ouyang et al., 2012 (link)). Nuclei were isolated using 0.1% Triton buffer, and sonicated in SDS lysis buffer using to ~300-500bp size. 5ug of antibody was complexed overnight to anti-rabbit magnetic beads (Invitrogen), and 100ug of chromatin was used per immunoprecipitation (IP) reaction. FoxO1 ChIP antibody (ab39670) was obtained from Abcam. Control rabbit-IgG was obtained from Santa Cruz Biotechnology. Samples were washed with low salt, high salt, LiCl, and TE buffers, eluted with SDS and reverse crosslinked overnight, followed by proteinase K digestion, and DNA purification. Samples were then subjected to quantitative PCR using published primer sets (Oestreich et al., 2008 (link)). A region outside of the promoter region ‘X-region’ was used as a negative control (forward, 5′ CAGTATGCAGCTCCTGTCTCC 3′; reverse, 5′ ACACCATGACCAAACCCAAG 3′), and FoxO1 KO P14 CTLs were used to control for antibody-IP specificity. Fold enrichment was calculated over rabbit IgG control.
+ Open protocol
+ Expand
2

Signaling Pathway Antibody Panel

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies against Hsp90β, TAK1, p-TAK1 (phospho-T187), TAB-1, ERK1/2, p-ERK1/2 (ERK1: phospho-Y204, ERK2: phospho-Y187), JNK1/2, p-JNK1/2 (phospho-T183/Y185), p38, p-p38 (phospho-T180/Y182), IκBα, p-IκBα (phospho-S32/S36), NF-κB p65, Bcl-2, cytochrome c, p-Bcl-2 (phospho-S87), p-p70S6 K (phospho-T389), p-mTOR (phospho-S2448), IKKα/β, p-IKKα/β (phsopho-S176/S177), HIF-1α, Lamin B1 (internal standard in nuclear protein fractions), β-actin (internal standard in cytosolic protein fractions) were from Abcam. Monoclonal antibodies against MKK3/6, p-MKK3/6 (MKK3: phospho-S189, MKK6: phospho-S207), AMPKα and phospho-AMPKα (phosphor-T172) were from Cell Signaling Technology and R&D Systems, respectively. Control rabbit IgG was from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated secondary antibodies were obtained from Calbiochem. Secondary antibodies coupled to IRDye800 fluorophore for use with the Odyssey Infrared Imaging System were purchased from Rockland. Hsp90 inhibitor, the water-soluble 17-DMAG, was purchased from Sigma Aldrich.
+ Open protocol
+ Expand
3

Immunoprecipitation of ATG3 in PC3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell extracts (1 mg) from empty-vector transfected or TNFAIP8-Myc-transfected PC3 cells were equilibrated in radioimmunoprecipitation assay buffer (RIPA; 50 mm Tris pH 8.0, 150 mM NaCl, 0.2 mM EDTA, 1% Nonidet P-40, and 1 mM phenylmethylsulfonyl fluoride, supplemented with protease inhibitor [Roche Applied Science]). The lysates were cleared with protein AG plus-agarose beads (Santa Cruz Biotechnology) and incubated with 1 μg of anti-ATG3 antibody (Sigma) or with control rabbit IgG (Santa Cruz Biotechnology) at 4° C overnight. Immune complexes were collected by adding 20 μl of protein AG-agarose beads equilibrated with lysis buffer. The immune complexes were washed three times with RIPA buffer, and proteins were resolved on a 4–12% Bis-Tris SDS-PAGE gel and transferred onto a PVDF membrane. The membranes were blocked with 1× blocking buffer and incubated with their respective primary (1:1000 dilution) and secondary antibodies (1:10000 dilution) as described above. Immunoreactive bands were visualized using a chemiluminescence system ECL.
+ Open protocol
+ Expand
4

ChIP Assay of T Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assay was performed using Pan T cells, CD4+CD25 T cells, TGF-β induced iTreg (93% purity) and CD4+CD25+Foxp3+ nTreg cells (purity more than 95%) as described previously (20 (link)). These cells were fixed (for 10 min at room temperature in 1% formaldehyde, 4.5 mM HEPES pH8.0, 9 mM NaCl, 0.09 mM EDTA, and 0.045 mM EGTA) and sonicated (Bioruptor) in lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris-HCl pH 8.0) with proteinase inhibitor (Sigma-Aldrich P8340). Pre-cleared lysates were incubated overnight at 4 °C with polyclonal anti-acetyl histone H4 (Millipore), anti-NF-κB p50 (Abcam, anti-p105/p50-ChIP grade) or control rabbit IgG (Santa Cruz). DNA fragments were isolated from the immuno-precipitated chromatin, and analyzed by real-time PCR with SsoFast EvaGreen supermix (Bio-Rad). PCR primers for ChIP used were as follows: κB1/κB2 forward, TTACACTGGAAACACCACAGGTGG; κB1/κB2 reverse, TGCTGGCTTCAAGGCAAGGATACA; kB3 forward, TGCATTCCACTCACGTCCAC; κB3 reverse, GGGCACTGTCCCTCAGCTAC.
+ Open protocol
+ Expand
5

Quantitative Analysis of Newly Synthesized KIT

Check if the same lab product or an alternative is used in the 5 most similar protocols
At 48 hrs post-siRNA transfection, GIST430 (ex 11) cells were starved in DMEM lacking methionine (and cysteine, Invitrogen Cat# 21013), supplemented with 5% dialyzed FBS and 2mM glutamine (N=4). Cells were then labeled with 100μCi/mL S35-methionine (EXPRE35S35S Protein Labeling Mix, PerkinElmer, Waltham, MA) for 30 minutes, washed twice with PBS, and lysed in RIPA lysis buffer. The supernatant was collected and immunoprecipitation was performed with KIT antibody (Abcam), or control rabbit IgG (Santa Cruz). Immunoprecipitated proteins were resolved by SDS-PAGE. Newly synthesized S35-KIT was visualized and quantitated on a Bio-Rad FX Molecular Imager using Quantity One Software (Bio-Rad).
+ Open protocol
+ Expand
6

Immunoprecipitation of IKKε in MDA MB 468 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoprecipitation was performed on MDA MB 468 cells using the Abcam immunoprecipitation kit (cat. No. ab206996), according to manufacturer’s instructions. Briefly, non-denaturing lysis buffer was used to collect 300 μg of cell lysate was incubated overnight with 3 μg/ml of either control rabbit IgG (Santa Cruz, cat. No. sc-2027) or IKKε rabbit polyclonal antibody (Abcam, cat. No. ab7891). Antibody bound proteins were captured using protein A/G sepharose beads, eluted, and analyzed via western blot. Antibodies used for western blot detection were purchased from Sigma (IKKε, cat. No. I4907), Santa Cruz (IKKα, cat. No. sc-7606 and NIK cat. No. sc-8417).
+ Open protocol
+ Expand
7

ChIP Analysis of Histone H4 Acetylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIPs were performed with a control rabbit IgG (Santa Cruz), an antibody to histone H4 (Active Motif), and an antibody to tetra-acetylated histone H4 (Active Motif) as described [14 (link)]. Primers detected the BRM promoter (-741) (5’-TTTGGAAGCTTGCAGTCCTT-3’) and (5’-TTTGTGGCACAGTGTGGACT-3’), and a BRM upstream region (-2700) (5’-ccttttaccctccaaccaca-3’) and (5;-AAGGCCTCAACACAGGAGAA-3’). Primers to the CD25 promoter were previously described [14 (link)].
+ Open protocol
+ Expand
8

FOXC2 ChIP-qPCR for HSC Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HSCs, cultured on 0.4 or 25.6 kPa hydrogels, were harvested for ChIP assay, ChIP assay was conducted using an EZ-Magna-ChIP HiSens kit (Millipore, #17-10461) as previously reported13 (link). Briefly, HSCs fixed with 1% formaldehyde and scraped from the hydrogels were subjected to nuclear lysis to release cross-linked protein/DNAs. The nuclear extract was then subjected to sonication and immunoprecipitation with anti-FOXC2 antibody (Abcam, #ab5060) or control rabbit IgG (Santa Cruz Technology, #sc-2027). Precipitated DNA fragments containing the promotor of ACTA2 (α-SMA), CTGF, FN1 and Col1A1 were quantitated by qPCR with the pair of primers. JASPAR software was used to predict the FOXC2 binding with the promoter of HSCs activation markers24 (link). The primers for ChIP-qPCR were displayed in Table S2.
+ Open protocol
+ Expand
9

Immunohistochemical Analysis of Kir2.1 in Mammary Glands

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were deeply anesthetized with an intraperitoneal injection of pentobarbital (0.2 mg/g body weight) and sacrificed by cutting right atrium. Then, the 4% paraformaldehyde fixative was perfused from the left ventricle. The fixed abdominal mammary glands of lactating and post-weaning mice were collected, dehydrated in alcohol, embedded in paraffin, and sliced into 3-μm-thick sections. Immunohistochemistry for Kir2.1 in mammary gland paraffin sections was performed using rabbit anti-Kir2.1 antibody (ab65796; Abcam) as described in the previous study [15 (link)]. Briefly, for antigen retrieval, the sections were heated at 105°C for 15 min in 20 mM Tris-HCl buffer (pH 8.0) after deparaffinization. The sections were incubated with anti-Kir2.1 antibody (1: 800) or control rabbit IgG (Santa Cruz Biotechnology, Dallas, TX, USA) overnight at 4°C, and then incubated with biotin-conjugated anti-Rabbit IgG Abs and horseradish peroxidase-conjugated streptavidin (Nichirei, Tokyo, Japan). For signal development, 3,3′-diaminobenzidine (DAB) tetrahydrochloride-H2O2 solution was used. The sections were counterstained with Mayer’s hematoxylin.
+ Open protocol
+ Expand
10

ChIP-Seq Profiling of Transcription Factors and Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP-Seq experiments were performed with 5 x 107 cells per assay with 10 μg of either rabbit anti- EBF1 (EMD Millipore AB10523), RBP-jκ Abcam AB25949), histone H3K4me3 (EMD Millipore 07–473), H3K4me1 (Active Motif 39297), H3K27me3 (Active Motif 39155) antibodies or control rabbit IgG (Santa Cruz Biotechnology sc-2027). ChIP was performed by as described previously with some modifications [42 (link)]. Briefly, crosslinked Mutu I or LCL lysates were sonicated to achieve a DNA fragment length of ~100–500 bp, incubated overnight with antibody-coated Dynabeads protein A/G, then washed with ChIP-seq wash buffer (50 mM HEPES, pH 7.5, 500 mM LiCl, 1 mM EDTA, 1% NP-40, 0.7% Na-Deoxycholate, 1x protease inhibitors) for 5 times, then washed once with 50 mM NaCl in TE buffer. Immunoprecipitated DNA was eluted with ChIP-seq elution buffer (50 mM Tris-HCl, pH 8, 10 mM EDTA, 1% SDS), reverse-crosslinked at 65°C, treated with RNase A (0.2 mg/ml) and proteinase K (0.2 mg/ml), purified with phenol and chloroform, then subjected to qPCR validation. Validated ChIP DNA was isolated by agarose gel purification, ligated to primers, and then subject to Illumina-based sequencing using manufacturers recommendations (Illumina).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!