Bovine serum albumin (bsa)

Cells were lysed in RIPA buffer (Cell Signaling, Beverly, MA) containing phosphatase and protease inhibitor cocktail (Cell Signaling). Protein levels were determined by BCA (Pierce). Samples were subjected to SDS-PAGE and transferred to PVDF membranes, blocked with 5% BSA (Lonza) in Tris-buffered saline with 0.1% Tween-20 (TBS-T), and incubated overnight at 4°C with primary antibodies; a-heregulin; a-ERK1/2 (Cell Signaling, clone 137F5, #4695) or a-pERK1/2, Thr202/Tyr204 (Cell Signaling, clone 197G2, #4377); a-HER3 (Cell Signaling, clone D22C5, #12708) or a-pHER3, Tyr1289 (Cell Signaling, clone D1B5, #2842); a-AKT (Cell Signaling, #9272) or a-pAKT, Ser473 (Cell Signaling, clone 193H12, #4058). All used 1:1.000. Goat anti rabbit horseradish peroxidase (HRP)-conjugated secondary antibodies was used at 1:10.000 (Cell Signaling, #7074). Proteins were either imaged using a FuijFilm LAS 4000 imager, using Lumi-Light plus western blot substrate (ROCHE, 12015196001) (Figure 4) or were develop on film using enhanced bioluminescence for HRP (ECL) was from GE Healthcare (Waukesha, WI, USA) (Figure 5).

For staining, 2 × 10⁵ cells/well were centrifuged in V-bottom 96-well plates and washed with phosphate-buffered saline (PBS, Lonza) containing 0.5% bovine serum albumin (Lonza), 1% FBS and 0.1% sodium azide. Non-specific binding was blocked by pre-incubating the cells with 40 μg/ml rat IgG (Sigma; 100 μl final volume, 20 min, 4°C). Cells were incubated with anti CXCR4-APC mAb (BD Pharmingen; clone 12G5) or isotype matched mAb (30 min, 4°C). Samples were analyzed on a Navios cytometer (Beckman Coulter).
For qRT-PCR, cell culture RNA was obtained using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The relative expression level of mRNA encoding human CXCR4 was determined by quantitative RT-PCR using GUS gene expression as internal control. cDNA was synthesized from 1 μg of total RNA with the Superscript IV First-Strand Synthesis System (Invitrogen). The cDNA was amplified in duplicate with primers for human CXCR4 (Hs00237052_m1, Applied Biosystems) and for human GUS (Fw: 5′-GAAAATATGTGGTTGGAGAGCTCATT−3′, Rv: 5′-CCGAGTGAAGATCCCCTTTTTA−3′; Probe: 5′-[6FAM] CCAGCACTCTCGTCGGTGACTGTTCA[TAMRA]−3′; all from Sigma). Amplification (1 cycle: 50°C for 2 min, 95°C for 10 min; 50 cycles: 95°C for 15 s, 60°C for 1 min) was monitored using the Roche LightCycler 480. Relative expression was analyzed using 2^−ΔCT method, where ΔCT = (Ct gene of interest- Ct internal control).

CII-specific T cells from draining LNs were enumerated and characterized using a DR1-CII tetramer [28 (link)]. Briefly, soluble DR1 covalently linked to the immunodominant CII peptide was produced in S2 cells, affinity-purified, biotinylated by BirA (Avidity, Aurora, CO, USA), and formed into multimeric units by stepwise addition of PE-labeled streptavidin (Rockland Immunochemicals, Limerick, PA, USA). For identification of CII-specific T cells ex vivo, LN cells were incubated with 1 μg of the tetramer at 37 °C for 2.5 h in complete HL-1 medium (50 U/ml penicillin G sodium, 50 μg/ml streptomycin sulfate, 0.05 mM β-mercaptoethanol, 2 mM l-glutamine, and 0.1 % bovine serum albumin; BioWhittaker/Lonza, Walkersville, MD, USA) supplemented with 5 mM NaN₃. At the end of the incubation, antibodies specific for various CD markers were added and cells were incubated for an additional 30 minutes at 4 °C. Samples were then washed and resuspended in PBS supplemented with 0.1 % NaN₃ and 2 % fetal bovine serum and analyzed by flow cytometry (BD LSR II). DR1-restricted, CII_257–274-specific and HA_306–318-specific T-cell hybridomas were used as positive and negative controls, respectively, to monitor the specificity and sensitivity of the DR1-CII tetramer (see Additional file 1).

To evaluate the nature of the MSCs, the isolated cells were induced to differentiate into osteogenic, chondrogenic, and adipogenic cell lineages.
For osteogenic differentiation, confluent passage-3 cells were cultured in DMEM medium supplemented with 50 mg/ml L-ascorbic 2-phosphate (Sigma, USA), 10 nM dexamethasone and 10 mM β-glycerophosphate (Sigma, USA) for 3 weeks. For adipogenesis, DMEM medium that contained 100 nM dexamethasone and 50 mg/ml indomethacin (Sigma, USA) was used to induce differentiation in the confluent cell culture for 3 weeks. To induce the cartilage differentiation, a micro-mass culture system was used. For this purpose, 2.5×10⁵ passage-3 cells were pelleted under 1200 g for 5 minutes and cultured in a DMEM medium supplemented with 10 ng/ml transforming growth factor-b3, 10 ng/ml bone morphogenetic protein-6 (BMP-6), 50 mg/ml insulin-transferrin-selenium+premix, 1.25 mg bovine serum albumin and 1% fetal bovine serum (All from Lonza Walkersville Inc, USA).
At the end of osteogenic differentiation, alizarin red (Sigma, USA) staining was used to observe matrix mineralization. After inducing the adipogenesis of stem cells, the cultures were stained by Oil red-O. To induce cartilage differentiation, the micro-mass culture system was used. The prepared sections were then stained by toluidine blue (Sigma, USA).

Cells were stained with respective anti-mouse monoclonal antibodies (Supplementary Table S1) for 30 min at 4°C, washed, and resuspended in sterile FACS buffer, containing 0.1% bovine serum albumin in phosphate buffered saline (PBS; Lonza, Basel, Switzerland). A 15 min long Fcγ receptor blocking step (unlabelled CD16/32, clone 2.4G2; BD Biosciences, Franklin Lakes, New Jersey, USA) preceded all stainings. Data were acquired on a FACSCantoII (BD Biosciences) and analyzed using FlowJo software V10 (FlowJo LLC, Ashland, Oregon, USA). Cells were sorted by FACSAria Fusion (Becton-Dickinson) at Research Facility Cell Sorting of Hannover Medical School. Apoptosis was assessed with FITC Annexin V Apoptosis Detection Kit (BD Biosciences).