Geldoc it imaging system

Reverse transcription was performed with PrimeScript RT Master Mix kit (TaKaRa Bio) according to the manufacturer’s instructions. After reverse transcription of extracted total RNA, total cDNA (25 ng) was used as template for RT-PCR with a thermal cycler (GeneAmp PCR system 9700; Applied Biosystems). The amplified PCR products were resolved via electrophoresis through 2 % agarose gel, stained with GelGreen (Biotium), and detected with a UV transilluminator (GelDoc-It Imaging System; UVP).
Quantitative PCR for measurement of transgenes expression was performed with SYBR Green I PCR Master Mix kit (Roche) according to the manufacturer’s instructions. After reverse transcription of extracted total RNA, total cDNA (10 ng) was used as template for quantitative PCR with a real-time PCR system (LightCycler 480II; Roche). The averaged threshold cycle number for housekeeping genes were adopted for ΔΔC_T-based relative quantification.

The primers LINR4 (5´ GGGGTTGGTGTAAAATAGGG 3′) and LIN19 (5′ CAGAACGCCCCTACCCG 3′) were used as described by Ikonomopoulos et al. [13 (link)]. All the reactions were performed in duplicate, with 2.5 μL of PCR buffer (50 mmol KCl, 10 mmol of Tris-HCl, 1.5 mM MgCl₂), 0.2 mM of deoxynucleotide triphosphate, 1.0 U of Taq Polymerase, 10 pmol of each initiator, 2 μL of DNA and 17.8 μL of ultrapure water to compose a final volume of 25 μL.
The amplification steps were carried out in a thermal cycler (MasterCycler® Personal, Eppendorf, Germany) according to Ikonomopoulos et al. [13 (link)], as follows: initial denaturation in a cycle at 95°C for three minutes, followed by 33 cycles at 95°C for 30 seconds, 58°C for 30 seconds and 72°C for one minute and a final extension of 72°C for seven minutes.
The amplified products were identified by means of gel electrophoresis in 1.5% agarose prepared in Tris-borato-EDTA (TBE) buffer 1.0 X and stained with ethidium bromide. The size of the amplified products was compared with the 100 bp ladder and visualized through Gel Doc - It™ Imaging System, using VisionWorks® LS Software (UVP, USA).

The glomeruli were isolated using a sieve, lysed in buffer (20 mM Tris, 140 mM NaCl, 2 mM EDTA, 10% glycerol, and 0.5% Triton X-100) containing protease inhibitor cocktail for 30 min, and centrifuged at 13,000× g at 4 °C for 20 min. Equal amounts of total protein were denatured (98 °C, 5 min) and then electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel. The proteins were transferred to PVDF membranes (2 h at 200 mA). The membranes were blocked (5% BSA, 0.05% Tween-20 in TBS) for 1 h at room temperature. The membranes were then incubated overnight at 4 °C with a primary antibody (rabbit anti-VEGF-A, 1:500; Merck KGaA, Darmstadt, Germany, Cat. No. AB1876-I; rabbit anti-β-actin, 1:1000, Sigma-Aldrich, Saint Louis, MO, USA, Cat. No. A2066). Membranes were washed (0.01% Tween-20 in TBS) and exposed to horseradish peroxidase-conjugated secondary antibody (anti-rabbit IgG; BD Pharmingen, Franklin Lakes, NJ, USA, Cat. No. 554021) for 1 h at room temperature. Super Signal West Pico PLUS chemiluminescent substrate (Thermo Fisher Scientific, Waltham, MA, USA) was used to detect reaction products. The GelDoc-It imaging system (UVP) was used to analyze and archive the membranes. The background signal was subtracted using the rolling disk method.