3 aminophenylboronic acid apb

Total RNA was isolated as previously described (25 ). For APB-affinity electrophoresis, samples were deacylated by incubation in 100 mM Tris pH 9.0 for 30 min. For oxidation control, RNA was deacylated and added to a solution containing 50 mM Tris pH 5.0 and 2 mM NaIO₄ for 2 h at 37°C in the dark. The oxidation reaction was quenched with 2.5 mM glucose before use. 25 mg of 3-aminophenylboronic acid (APB) (Sigma) was added to 10 ml of 8M-urea 8% polyacrylamide mix before solidifying (26 (link)). Electrophoresis of APB gels was carried out for approximately 5 hrs at 75 V, at 4°C and electroblotted to Zeta-probe membranes. The membrane was then UV cross-linked for 1 min. Northern hybridization was performed according to the manufacturer (Bio-Rad) using γ-ATP ³²P-labeled oligonucleotides. Following hybridization, membranes were exposed overnight on a phosphoimager screen. Blots were analyzed using a Typhoon FLA 9000 scanner and the ImageQuant TL software (GE Healthcare). Probes used for Northern hybridization were as follows: tRNA^Tyr: GTGGTCCTTCCGGCCGGAATCGAA; tRNA^Glu: TTCCGGTACCGGGAATCGAAC; tRNA^His: CCACTCAACTATCTTCCC; tRNA^Asp: CGGGTCACCCGCGTGACAGG; tRNA^Asn: CTCCTCCCGTTGGATTCG; 7SL: GCTGCTACTGGGAGCTTCTCATAC; 12S rRNA: AGGAGAGTAGGACTTGCCCT; E. coli tRNA^Asp: AACGGACGGGACTCGAACCCGCGAC; E. coli tRNA^Ile: CCTGAGTGGACTTGAACCACCGACC.