Paav cag egfp

Manufactured by Addgene

PAAV:CAG-EGFP is a plasmid vector that contains the Cytomegalovirus (CMV) immediate-early enhancer/chicken beta-actin (CAG) promoter driving the expression of enhanced green fluorescent protein (EGFP). This vector can be used for the expression of EGFP in various cell types.

Automatically generated - may contain errors

Lab products found in correlation

Block it pol 2 mir rnai kit, by Thermo Fisher Scientific (1 mentions) Pgp aav cag flex jgcamp8s wpre, by Addgene (1 mentions) Paav cag tdtomato, by Addgene (1 mentions) Paav hsyn dio hm3d gq mcherry, by Addgene (1 mentions)

2 protocols using paav cag egfp

Engineered AAV Capsid Variants for In Vivo Studies

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The AAV capsid variants such as AAV-MaCPNS1 (Addgene plasmid # 185136) and AAV-MaCPNS2 (Addgene plasmid # 185137) capsids were built by inserting 7-mer peptides between AAs 588–589 of the AAV9 cap gene in the pUCmini-iCAP-PHP.B backbone ((Deverman et al. 2016 (link)), Addgene plasmid # 103002). The AAV-PHP.S capsid was described previously ((Chan et al. 2017 (link)), Addgene plasmid # 103006).
For in vivo validation of AAV capsids, we packaged the vectors with a single-stranded (ss) rAAV genome: pAAV:CAG-2xNLS-EGFP (Deverman et al. 2016 (link)) (available from Caltech CLOVER Center upon request, a similar version with 1xNLS is in Addgene, plasmid # 104061), pAAV:CAG-EGFP, pAAV:hSyn1-tdTomato (a gift from Hongkui Zeng, Addgene plasmid # 51506, (Oh et al. 2014 (link))), pAAV:CAG-tdTomato (a gift from Edward Boyden, Addgene plasmid # 59462), pAAV:hSyn-DIO-hM3D(Gq)-mCherry (a gift from Bryan Roth, Addgene plasmid # 44361, (Krashes et al. 2011 (link))). To make the pAAV:CAG-jGCaMP8s plasmid, jGCaMP8s was synthesized as a gBlocks Gene Fragment (IDT) based on the sequence in the plasmid pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (Addgene plasmid # 162380) and subcloned into the plasmid pAAV:CAG-EGFP by replacing the EGFP gene.

Chen X., Kumar S.R., Adams C.D., Yang D., Wang T., Wolfe D.A., Arokiaraj C.M., Ngo V., Campos L.J., Griffiths J.A., Ichiki T., Mazmanian S.K., Osborne P.B., Keast J.R., Miller C.T., Fox A.S., Chiu I.M, & Gradinaru V. (2022). Engineered AAVs for non-invasive gene delivery to rodent and non-human primate nervous systems. Neuron, 110(14), 2242-2257.e6.

+ Open protocol

+ Expand

Generation of amiR constructs targeting PRMT6 and LSD1

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

amiRs targeting either PRMT6 or LSD1 in mouse and human cells were designed with the online tool BLOCK-iT RNAi Designer (Supplementary Table 3). amiRs were inserted into pcDNA6.2-GW/EmGFP-miR plasmid using the BLOCK-iT Pol II miR RNAi kit (Invitrogen, #K493600) and carrying a spectinomycin resistance cassette^{107 (link)}. The expression cassette consisted of a 5′ miR flanking region, target-specific stem-loop amiR sequence, and 3′ miR flanking region. This amiR cassette can be expressed from the 3′ untranslated region of any reporter gene under the control of an RNA polymerase type II promoter^{108 (link)}. As a negative control, we used the control amiR sequence from pcDNA6.2-GW/EmGFP-miR-neg-control plasmid (provided with the kit) containing a sequence that does not target any known vertebrate gene (control amiR: AAATGTACTGCGCGTGGAGAC). Top-10 competent E. coli were transformed, and positive clones were selected using EGFP forward primer 5′-GTCCTGCTGGAGTTCGTG-3′. amiR sequences against PRMT6 (#1: TGCTGAATCAGACCATGTTGCCTTTCGTTTTGGCCACTGACTGACGAAAGGCAATGGTCTGATT) and LSD1 (#2: TGCTGTTGATGAGAGGTATACATCACGTTTTGGCCACTGACTGACGTGATGTACCTCTCATCAA) were sub-cloned downstream of EGFP under control of the CAG promoter in an AAV vector derived from pAAV-CAG-EGFP (Addgene, #37825)^{107 (link)}.

Prakasam R., Bonadiman A., Andreotti R., Zuccaro E., Dalfovo D., Marchioretti C., Tripathy D., Petris G., Anderson E.N., Migazzi A., Tosatto L., Cereseto A., Battaglioli E., Sorarù G., Lim W.F., Rinaldi C., Sambataro F., Pourshafie N., Grunseich C., Romanel A., Pandey U.B., Contestabile A., Ronzitti G., Basso M, & Pennuto M. (2023). LSD1/PRMT6-targeting gene therapy to attenuate androgen receptor toxic gain-of-function ameliorates spinobulbar muscular atrophy phenotypes in flies and mice. Nature Communications, 14, 603.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!