Rnai ready psiren retroq dsred express vector

RAW264.7 macrophages were obtained from the American Type Culture Collection (#IB-71) and maintained in complete DMEM, 4.5 g/l glucose with 10% (vol/vol) heat-inactivated fetal calf serum (PAA, Austria), and 2 mM l-glutamine (PAA, Pasching, Austria). BMMs were isolated and maintained as described previously (Kasmapour et al., 2012 (link)). Cells were incubated at 37°C/5% CO₂ in a humidified incubator. For IFN-γ stimulation, RAW264.7 macrophages and BMMs were stimulated with 5 ng/ml IFN-γ (Peprotech, Hamburg, Germany) for 16–20 h. Recombinant mouse EGF was from BioLegend (San Diego, CA). LysoTracker Red DND-99 was from Invitrogen. The mouse Rab20 gene was amplified by standard PCR from mouse DNA with specific primers and cloned into pEGFP-C1 and pmCherry-C1 vectors (Clontech, Carlsbad, CA). pEGFP-C1-Rab20T19N (Rab20DN) plasmid was generated by site-directed mutagenesis using a QuikChange II XL mutagenesis kit (Agilent Genomics, Santa Clara, CA). RNAi-Ready pSIREN-RetroQ-DsRed-Express vector was obtained from Clontech. EGFP-Rab5 was kindly provided by Philip D. Stahl (Washington University, St. Louis, MO), and EGFP-Rab7 and tdTomato-LAMP1 were kindly provided by Bo Van Deurs (University of Copenhagen, Copenhagen, Denmark) and Tom Carter (Medical Research Council-National Institute for Medical Research, London, United Kingdom), respectively.

Stable FliI KND fibroblast cells were developed using the following oligonucleotides. For the top strand: 5′-gatccGAAGATACACA­CTATGTTATTCAAGAGATAACATAGTGTGTATCTTCTTTTTTAC­GCGTg—3′; and for the bottom strand: 5′-aattcACGCGTAAAAAAGAAGATACACACTATGTTATCTCTTGAATAACATAGTGTGTATCTTCg—3′ corresponding to the sense 5′-GAAGATACACACTATGTTA-3′ and antisense 5′-TAACATAGTGTGTATCTTC-3′ for mouse FliI annealed and inserted into an RNAi-Ready pSIREN-RetroQ-DsRed-Express vector (Clontech) at BamHI/EcoRI sites. Insert sequences were confirmed by sequencing. The plasmid was cotransfected with pVSV-G into GP-293 cells for retrovirus production. NIH-3T3 cells were infected with the virus; 2 wk later, the transfected cells were sorted in PBS/0.5% FBS with a Beckman-Coulter Altra flow cytometer/sorter. Cells with strong red fluorescence were cloned by limiting dilution. There was 90% knockdown of FliI expression in these cells (Arora et al., 2015 (link)). A FliI WT 3T3 cell line was created by stably transfecting of a scrabble Luciferase RNA sequence 5′-GTGCGTTGCTAGTACCAACTTCAAGAGA-3′.