The largest database of trusted experimental protocols

High capacity cdna reverse transcriptation kit

Manufactured by Thermo Fisher Scientific

The High-capacity cDNA reverse transcription kit is a laboratory tool designed for the conversion of RNA into complementary DNA (cDNA) in a single-step reaction. It provides a high-capacity reverse transcription process, enabling efficient and reliable cDNA synthesis from a wide range of RNA input amounts.

Automatically generated - may contain errors

2 protocols using high capacity cdna reverse transcriptation kit

1

Quantitative RT-PCR for ZMYND8 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using RNease kits (#74104, Qiagen), and cDNA was synthetized with a high-capacity cDNA reverse transcriptation kit (#4368813, Applied Biosystems). Quantitative Real-time RT-PCR was conducted using the ABI 7900 HT Fast Real Time PCR system (Applied Biosystems, Foster City, CA) as previously described (Yeo et al. 2018 ). The primer sequences of ZMYND8 were as follows : The forward primer was GGGTTTATCACGCTAAGTGTCTG, and the reverse primer was GGCTTTACTCTGGGTCTCGATG.
+ Open protocol
+ Expand
2

Quantitative RT-PCR for ZMYND8 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using RNease kits (#74104, Qiagen), and cDNA was synthetized with a high-capacity cDNA reverse transcriptation kit (#4368813, Applied Biosystems). Quantitative Real-time RT-PCR was conducted using the ABI 7900 HT Fast Real Time PCR system (Applied Biosystems, Foster City, CA) as previously described (Yeo et al. 2018 ). The primer sequences of ZMYND8 were as follows : The forward primer was GGGTTTATCACGCTAAGTGTCTG, and the reverse primer was GGCTTTACTCTGGGTCTCGATG.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!