Rna clean and concentrator 25

Two hundred and fifty microliters of homogenized tissue were suspended in 1 ml of Trizol (ThermoFisher) and frozen at −80°C until extraction. RNA was extracted following manufacturer’s protocol. Extracted RNA was DNase treated with 10 units RQ-1 RNase free DNase (Promega) following manufacturer’s protocol. RNA was purified after DNase treatment using RNA Clean and Concentrator-25 (Zymo) and eluted in 30 μl of H2O, and quantified using a NanoDrop spectrophotometer. Five hundred nanograms of total RNA were used to generate cDNA using SuperScript II Reverse Transcriptase (ThermoFisher) and Random Primer 9 (NEB) following manufacturer’s protocol. Copy number of lasA and gyrA were quantified using iTaq Universal Sybr Green master mix (Bio-Rad) in 20 ul reaction volumes on a Roche LightCycler 96, using the following primer pairs: lasA_RT_5 5’-CCTGTTCCTCTACGGTCGCG-3’, lasA_RT_3 5’-GGTTGATGCTGTAGTAGCCG-3’, gyrA_5_RT 5’-GAAGCTGCTCTCCGAATACC-3’, gyrA_3_RT 5’-CAGTTCCTCACGGATCACCT-3’.

Plant tissue was ground in liquid nitrogen, and then, RNA was extracted using TRI Reagent (Molecular Research Center, Inc.) according to the manufacturer's instructions. The resulting RNA was DNaseI (Promega) treated at 37°C for 30 min and then cleaned using RNA clean and concentrator‐25 (Zymo Research). Superscript III (Invitrogen) was used to reverse transcribe 1 ug of RNA into cDNA according to the manufacturer's instructions. cDNA was used as a template for qRT‐PCR using gene‐specific primers and Ubiquitin‐conjugating enzyme (Sekhon et al., 2011) or 45S rRNA (Hale, Erhard, Lisch, & Hollick, 2009) primers for internal control (Table S3) with SYBR Green Master Mix (Applied Biosystems) per the manufacturer's instructions on a 7500 Fast Real‐Time PCR System (Applied Biosystems). Relative expression changes were calculated using 2^−∆∆Ct (Livak & Schmittgen, 2001). All data represent two technical replicates.

100 ng polyA⁺ RNA was assembled in a total volume of 6 µl with 1 µl 10 µM RT primer (5′-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′, IDT) and 1 µl 10 mM dNTPs (Thermo Fisher Scientific, R0191). The primer was annealed by incubation for 5 min at 75 °C, followed by 2 min at 42 °C. In a new tube, the template switching RT mix was prepared, composed of 2.5 µl 4x template switching RT buffer, 1 µl 10x template switching RT enzyme mix (New England Biolabs, M0446S) and 0.5 µl 20 µM template switching oligo (5′-ACTCTAATACGACTCACTATAGGGAGAGGGCrGrG+G-3′, IDT). RNA and RT mix were combined and incubated in a thermocycler (60 min, 42 °C; 10 min, 68 °C). For Second Strand Synthesis, 50 µl Q5 Hot Start High Fidelity Master Mix (New England Biolabs, M0494S), 5 µl RNase H (New England Biolabs, M0297), 2 µl 10 µM T7 extension primer (5′-GCTCTAATACGACTCACTATAGG-3′, IDT) and 33 µl H₂O were added. Second Strand Synthesis was carried out in a thermocycler (15 min, 37 °C; 1 min, 95 °C; 10 min, 65 °C). The product was cleaned up employing the NucleoSpin kit (Macherey Nagel, REF 740609.50) and subjected to in vitro transcription with the T7 MegaScript kit (Thermo Fisher Scientific, AM1333) according to the manufacturer’s instructions. The generated IVTs were cleaned up on RNA Clean and Concentrator-25 (Zymo Research, R1017).

All cultures were harvested during mid-exponential growth phase by centrifugation in an Eppendorf 5810R centrifuge using the A-4-62 rotor at 3200 rcf for 15 min at 15°C. The supernatant was carefully decanted, and 1–2 ml of TRI reagent (Ambion) was added to the pellet and vortexed until the pellet fully dissolved. Homogenates were then either processed immediately using Ribopure kit (Ambion), or stored at −80°C for later processing. The eluted RNA was treated with DNase (Sigma) to remove DNA contamination. Samples were cleaned and concentrated using RNA Clean and Concentrator-25 (Zymo Research). The RNA was quantified using a Qubit 2.0 Fluorometer (Invitrogen) and nucleic acid quality was checked using an E-gel Gel EX 1% (Invitrogen).

sgRNA target site for murine REEP6 was selected using the CRISPR design tool (http://crispr.mit.edu/, AGAGTGGTCTTATGACGCGATGG). As previously described (19 (link)), Reep6 sgRNA was cloned into pDR274 to generate a T7 promoter-mediated sgRNA expression vector. Linearization of the vector was achieved by BsaI digestion. sgRNA was produced using the linearized vector (Maxiscript T7 kit, Life Technologies) and purified with RNA Clean and Concentrator-25 (Zymo Research). Cas mRNA was made as previously described (19 (link)). For microinjections to generate Reep6 K0 mice, Cas mRNA (40 ng/ul) and sgRNA (20 ng/ul) were mixed and microinjected into C57BL/6 embryos at the single-cell stage. To genotype Reep6 KO mice, we used a genomic PCR assay using the following primers: Reep6_F: TCCTGTTCTGGTTCCCTTTCTA and Reep6 _M13R: CTGCTCAGGAAACAGCTATGACGGAAAAATAAATCCAGCATCCA.
All mice in this study were housed under 12-h light and 12-h dark cycles. All animal operations were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.

Saliva was collected from four healthy volunteers who each gave 3 x 1 ml samples which were each mixed with 1 ml RNAlater (Sigma-Aldrich, cat no. R0901). 1 ml of the saliva and RNAlater mix from each volunteer was mixed into three separate pool replicates, which were then centrifuged at 1000 rpm for ten minutes to remove cell debris. Four different extraction kits were compared; Qiagen DNA/RNA AllPrep Mini Kit (cat no. 80204), Zymo RNA Clean and Concentrator-25 (cat no. R1017) (following a traditional phenol-chloroform extraction), Zymo DirectZol Miniprep Plus kit (cat no. R2051) and Zymo Quick Prep RNA (cat no. R1050). 800 μl of sample and preservative mix from each pool was extracted using each of the four kits. Manufacturer’s protocols were followed except for Zymo DirectZol Miniprep Plus kit, where a 6:1 ratio of QIAzol (Qiagen, cat no. 79306) to sample was used instead of 10:1.