Total RNA was isolated from THCA cells using TRIzol reagent (Invitrogen). The cDNA was synthesized using the PrimeScript RT reagent Master Mix (Takara). RT‐qPCR was performed by the SYBR Premix Ex Taq kit (Takara). Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) or U6 small nuclear RNA (snRNA) was used as the control. The PCR primer sequences were shown as followings: GAPDH, forward, 5′-GCA CCG TCA AGG CTG AGA AC-3′ and reverse, 5′-TGG TGA AGA CGC CAG TGG A-3′; U6, forward, 5′ATA CAG AGA AAG TTA GCA CGG-3′and reverse, 5′-GGA ATG CTT CAA AGA GTT GTG-3′; RUNDC3A-AS1, forward, 5′-TCC AGA ACT GGA AAC TAC CC-3′ and reverse, 5′- GCC ATT TGT CAT TGT CTT CCT-3′; si-RUNDC3A-AS1#1, forward, 5′-AAU CUG AAU CAA UGU AGA GAC-3′ and reverse, 5′- CUC UAC AUU GAU UCA GAU UUG -3′; miR-151b, forward, 5′- ACA CTC CAG CTG GGT CGA GGA GCT CA′ and reverse, 5′- TGG TGT CGT GGA GTC G-3′; miR-151b mimics, 5′-UCG AGG AGC UCA CAG UCU-3′; SNRPB, forward, 5′-CCG GAT CTT CAT TGG CAC CT-3′ and reverse, 5′-AGG ACT CGC TTC TCT TCC CT-3′. The relative gene expression was normalized to control by the 2−ΔΔCt method.
Primescript rt reagent master mix
Manufactured by Takara Bio
Sourced in China, Japan
PrimeScript RT reagent Master Mix is a ready-to-use solution for reverse transcription (RT) reactions. It contains all the necessary components for efficient cDNA synthesis, including RNase inhibitor and reverse transcriptase enzyme.
Automatically generated - may contain errors
Lab products found in correlation
Sybr premix ex taq kit, by Takara Bio (2 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Lightcycler 480 2 real time pcr system, by Roche (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Nanophotometer np80, by Implen (1 mentions)
4 protocols using primescript rt reagent master mix
1
Quantifying Gene Expression in THCA Cells
2
Quantitative Analysis of circRNA, miRNA, and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples and cells with RNAiso Plus (Takara, Dalian, China). Next, the complementary DNA was synthesized with the PrimeScript RT reagent Master Mix (Takara) or Mir‐X miRNA First‐Strand Synthesis Kit (Takara). QRT‐PCR was executed by using a Light Cycler 480 II Real‐Time PCR System (Roche, Basel, Switzerland) with the SYBR Premix Ex Taq kit (Takara). The 2−ΔΔCt method was utilized to calculate the expression of circ_0000518, miR‐326, and FGFR1, and glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) or U6 small nuclear RNA (snRNA) was used as the control. The primers were used as below: circ_0000518: (F:5′‐AGGTGAGTTCCCAGAGAACGG‐3′ and R:5′‐AGTGGAGTGACAGGACGCA‐3′); GAPDH: (F:5′‐GACTCCACTCACGGCAAATTCA‐3′ and R:5′‐TCGCTCCTGGAAGATGGTGAT‐3′); miR‐326: (F:5′‐CCTCTGGGCCCTTCCTCCAG‐3′ and R:5′‐GCTGTCAACGATACGCTACCTA‐3′); U6 snRNA (F:5′‐GCTCGCTTCGGCAGCACA‐3′ and R:5′‐GAGGTATTCGCACCAGAGGA‐3′); FGFR1: (F:5′‐CCCGTAGCTCCATATTGGACA‐3′ and R:5′‐TTTGCCATTTTTCAACCAGCG ‐3′).
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from thye cultured cells using TRIzol reagent [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China] and 1.0 µg of total RNA was used for cDNA synthesis using the PrimeScript RT reagent Master mix (Takara Biotechnology (Dalian) Co., Ltd.). Quantitative (real-time) PCR (qPCR) was performed using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara Biotechnology (Dalian) Co., Ltd.) with an ABI PRISM 7500 Fast Real-Time PCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) with the following program: 95°C for 30 sec, 95°C for 5 sec, 60°C for 1 min, and 95°C for 30 sec, for 40 cycles. The results were analyzed using the 2−∆∆CT method. β-actin gene expression was measured as an endogenous control. Experiments were carried out in technical triplicates and were repeated at least twice independently. Primers were custom ordered (Boshang Biotechnology Co., Ltd, Shanghai, China) with the following sequences: Bmi-1 forward, 5′-TCTGGGAGTGACAAGG-3′ and reverse, 5′-AAACAAGAAGAGGTGGA-3′; E-cadherin forward, 5′-TGCCCAGAAAATGAAAAAGG-3′ and reverse, 5′-GTGTATGTGGCAATGCGTTC-3′; β-actin forward, 5′-GCCAACACAGTGCTGTCTG-3′ and reverse, 5′-TACTCCTGCTTGCTGATCCA-3′.
4
Tribolium castaneum Gene Expression Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A suite of processes for T. castaneum feeding assays, total RNA extraction, and cDNA transcription was performed to validate RNA-Seq. The reagents and measurement tools were identical to the ones described above. Biological samples were prepared independently of those for the RNA-Seq analysis. The single-strand cDNA was synthesized from 500 ng total RNA using PrimeScript RT reagent master mix (TaKaRa Bio, Shiga, Japan) in accordance with the manufacturer's instructions, and the concentrations and qualities were measured using a NanoPhotometer NP80 (Implen, München, Germany). Both oligo dT and Random 6 primers were used as the anchor primer. Quantitative RT-PCR was performed using SYBR Premix Ex Taq II (Tli RNaseH Plus, TaKaRa Bio) with a StepOnePlus (Thermo Fisher Scientific). The relative expression levels were calculated using the 2-ΔΔCt method. The specificity of sequences of primers and amplified regions was confirmed by BLASTN searches against the Tribolium genome in the NCBI database. The internal standard gene, RpS3 (T. castaneum ribosomal protein S3—NCBI accession: NM_001172392.1) was used as a housekeeping gene because of its expression stability through the different life stages, viz., from larva to adult [23 (link), 24 (link)]. The primer sequences used for these analyses are shown in S1 Table .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!