Cfx96 machine

Total RNAs from the various sampled tissues were isolated using the modified CTAB method reported previously [80 (link)]. First-strand cDNAs were synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s protocol. qRT-PCR was run on a Bio-Rad CFX96 machine with SYBR® Premixm Ex Taq™ (TaKaRa, Japan). CsGAPDH (TEA025584.1) was used as an internal control. Data were analyzed with Opticon monitor software (Bio-Rad). All primers for qRT-PCR were designed using Primer 5.0 software and primer sequences are listed in Table S1. All the experiments were performed with three biological replicates. The 2^–ΔCT method was used to calculate the relative expression level [82 (link), 83 (link)].

Total RNA from each sample was extracted using Trizol reagent. RNA quality and purity were determined using 2% agarose gel electrophoresis and ultraviolet spectrophotometry, respectively. The reverse-transcribed cDNA was synthesized using the Prime Script RT Reagent Kit and stored at -20°C. Primers were designed using the Primer 3.0 online program based on the CDS sequence of NtCXE genes for quantitative real-time (qRT)-PCR. An Applied Biosystems CFX96 machine was used for the qRT-PCR with the SYBR qPCR kit (TaKaRa). The tobacco ribosomal protein gene, L25 (GenBank No. L18908), was used as an internal reference, and three biological replicates were performed (Schmidt and Delaney, 2010 (link)). The gene primers used in this study are listed in Supplementary Table 2.

MDH and ipsilateral trigeminal ganglia (TG) were harvested on POD 14 from both sham and CCI-ION rats and flash-frozen in liquid nitrogen. Total RNAs were extracted using Trizol reagent (Invitrogen, Grand Island, NY, USA) and reverse transcribed using PrimeScript™ RT Master Mix (Takara, Japan), following the manufacturer’s protocol. Quantitative RT-PCR (qRT-PCR) analyses were conducted on a Bio-Rad CFX96 machine using SYBR Premix Ex Taq (Takara, Japan) (Primers: IL-6, Forward, TGATGGATGCTTCCAAACTG; Reverse, GAGCATTGGAAGTTGGGGTA and β-Actin, Forward, CACCCGCGAGTACAACCTTC; Reverse, CCCATACCCACCATCACACC). The expression levels of target genes were quantified relative to the level of β-Actin gene expression using the 2^−ΔΔCT method. Real-time PCR experiments for each gene were replicated three times.