Polybrene

Manufactured by Beyotime

Sourced in China

Polybrene is a cationic polymer used as a transfection reagent in cell biology experiments. It facilitates the uptake of DNA, RNA, or other macromolecules into cells by neutralizing the negative charge on the cell membrane, allowing for increased cellular permeability.

Automatically generated - may contain errors

Lab products found in correlation

Puromycin, by Beyotime (21 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (8 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions) Lipo8000, by Beyotime (4 mentions) Lipo8000 transfection reagent, by Beyotime (2 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions) 24 well plate, by Corning (2 mentions) Puromycin, by Solarbio (2 mentions) Oe mettl3, by GenePharma (1 mentions) Sh ythdf2, by GenePharma (1 mentions) Lv sh mettl3, by GenePharma (1 mentions) Ant pr 1, by InvivoGen (1 mentions) Lipofectamine 3000 kit, by Thermo Fisher Scientific (1 mentions) Ad gfp, by Genechem (1 mentions) Plvx puro lentivirus vector, by Takara Bio (1 mentions) Lipofectamine 6000, by Beyotime (1 mentions) Lenti easy packaging system, by Genechem (1 mentions) Lipo3000, by Thermo Fisher Scientific (1 mentions) Virapower mix, by Thermo Fisher Scientific (1 mentions) Pcdh cmv mcs ef1 copgfp vector, by System Biosciences (1 mentions)

59 protocols using polybrene

Lentivirus-Mediated FTO and miR-27a-3p Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target cells at a density of 1×10
⁶ cells/well were seeded into 6-well plates and cultured for 24 h in growth medium with 10% FBS. Next, cells were transduced with lentivirus (lv) lv-sh-NC, lv-sh1-FTO, or lv-sh2-FTO (for FTO knockdown), lv-NC, lv-FTO (for FTO overexpression), or agomir-27a-3p/antagomir-27a-3p (for miR-27a-3p overexpression or inhibition) using polybrene (Beyotime) or Lipofectamine® 3000 reagent (Thermo Fisher Scientific, Waltham, USA) according to the manufacturer’s protocols. The sequences are shown in
Supplementary Table S1.

Du P., Meng L., Liao X., Liu Y., Mo X., Gong M, & Liao Y. (2023). The miR-27a-3p/FTO axis modifies hypoxia-induced malignant behaviors of glioma cells: miR-27a-3p/FTO affects glioma growth. Acta Biochimica et Biophysica Sinica, 55(1), 103-116.

+ Open protocol

+ Expand

METTL3 and YTHDF2 Regulation in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Silencing of METTL3 was achieved by transducing lentivirus containing short hairpin RNA targeting METTL3 (Lv-sh-METTL3, GenePharma, Shanghai, China). METTL3 overexpression was achieved by transducing plasmid overexpressing METTL3 (METTL3 OE, GenePharma). Silencing of PTEN was achieved by transducing lentivirus containing short hairpin RNA targeting PTEN (Lv-sh-PTEN, GenePharma, Shanghai, China). YTHDF2 silencing or overexpression was achieved by transducing sh-YTHDF2 or YTHDF2 OE vector (GenePharma). Scramble sequence shRNA or empty plasmid was used as negative control (sh-NC/vector). Cell transduction was performed using polybrene (Beyotime) or Lipofectamine 3000 (Invitrogen).

Li J., Yao H., Huang J., Li C., Zhang Y., Xu R., Wang Z., Long Z., Tang J, & Wang L. (2022). METTL3 promotes prostatic hyperplasia by regulating PTEN expression in an m6A-YTHDF2-dependent manner. Cell Death & Disease, 13(8), 723.

+ Open protocol

+ Expand

Lentiviral-mediated Knockdown in GC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard protocols were followed to generate viruses, and packaging lentiviruses were used for constructing the stable transgenic cells.
The lentiviral packaging plasmids psPAX2 and pMD2.G and shRNA were used to generate the lentiviral particles in the HEK293T cells.
The supernatants containing virus particles were collected at 48 h and 72 h post-transfection and concentrated using a lentivirus precipitation
solution (#FV101-01, Transgen Biotech, Beijing, China). The concentrated virus particles and polybrene (1:1000, #C0351, Beyotime, Shanghai, China)
were used to infect the GC cells grown in 6-well plates. The stable shRNA-expressing cells were selected using puromycin
(0.25 mg/mL, #ant-pr-1, InvivoGen, San Diego, CA, USA) for 3–5 days. The shRNA sequences were as follows:
shRNA#1: 5′-CCGGAGAGTTGTGGACTTTAT-3′.
shRNA#2: 5′-CAACCTCACGACCGGATCAT-3′.
shRNA#3: 5′-GCAACGGGTGGAGCAGTTTGC-3′.

Wang W., Wang M., Du T., Hou Z., You S., Zhang S., Ji M., Xue N, & Chen X. (2023). SHMT2 Promotes Gastric Cancer Development through Regulation of HIF1α/VEGF/STAT3 Signaling. International Journal of Molecular Sciences, 24(8), 7150.

+ Open protocol

+ Expand

Lentiviral Knockdown of Bax Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

For shRNA constructs, Bax target sequences and a scrambled sequence were individually cloned into a pLKO.1-TRC vector (AgeI and EcoRI sites).
For lentiviral particle production, 5 μg of shRNA construct, 3.75 μg of psPAX2, and 1.5 μg of pMD2.G were co-transfected into HEK293FT cells (70–80% confluence) in a 6 cm dish. The supernatant containing lentivirus was harvested twice at 48 and 72 h after transfection and further filtered through a 0.45 μm filter before use. To infect the GC cells with lentivirus, they were cultured in a medium containing a lentivirus supplement with 1 mg/mL polybrene (Beyotime, C0351 Sigma).

Li Y., Fan B., Pu N., Ran X., Lian T., Cai Y., Xing W, & Sun K. (2022). Isorhamnetin Suppresses Human Gastric Cancer Cell Proliferation through Mitochondria-Dependent Apoptosis. Molecules, 27(16), 5191.

+ Open protocol

+ Expand

LINC01060 Knockdown Using Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

LINC01060 knockdown was achieved in target cells by transducing lentivirus containing short hairpin RNA against LINC01060 (Lv-shLINC01060–1/2; GenePharma, Shanghai, China). The sequences for Lv-shLINC01060–1/2 construction are listed in Table S1. Polybrene (Beyotime, Shanghai, China) was acquired to help in cell transduction.

Zhang Q., Tang X., Zhou Y., Chen X., Peng K., Jiang R., Liu Z., Song X, & Xia H. (2023). LINC01060 knockdown inhibits osteosarcoma cell malignant behaviors in vitro and tumor growth and metastasis in vivo through the PI3K/Akt signaling. Cancer Biology & Therapy, 24(1), 2198904.

+ Open protocol

+ Expand

Genechem Lentiviral Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

A set of two different plasmids (Genechem) carrying shRNA (5' CGACTCTTCTGTGATGTGTAT 3' and 5' CATCCGGATCACTGAGAAGAT 3') targeting CFP1 were inserted in lentiviral vectors respectively. Virus particles were produced by co-transfected 293 T cells with target plasmids and virus package plasmids (Syngentech) according to the manufactory protocol of the Lipofectamine 3000 kit (Invitrogen). After 48 h, viral supernatant was collected and transduced to target cells with 8 μg/mL polybrene (Beyotime). Puromycin (Beyotime) was diluted in the complete culture medium (final concentration 2 μg/mL) to select transfected successfully cells for 2 weeks. The CFP1 overexpression plasmid and vector control plasmid (Genechem) were transfected in H1975 cells with Lipofectamine 3000 (Invitrogen). After 48 h, the protein overexpression efficiency was detected by western blotting.

Fan T., Xiao C., Liu H., Liu Y., Wang L., Tian H., Li C, & He J. (2023). CXXC finger protein 1 (CFP1) bridges the reshaping of genomic H3K4me3 signature to the advancement of lung adenocarcinoma. Signal Transduction and Targeted Therapy, 8, 369.

+ Open protocol

+ Expand

Lentiviral Silencing of Opioid Receptor μ1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral plasmids containing a short hairpin RNA (shRNA) for the gene that encodes MOR (OPRM1) and a negative control were purchased from Zorin Biological Technology (Zorin Biological Technology, Shanghai, China). The sequence of shRNA‐MOR was: Forward 5’‐ GATCCGGATCCTCTCTTCTGCCATTG CTTCCTGTCAGACAATGGCAGAAGAGAGGATCCTTTTTG ‐3’ and Reverse 5’‐ AATTCAAAAAGGATCCTCTCTTCTGCCATTGTCTGACAGGAAG CAATGGCAGAAGAGAGGATCCG ‐3’. Before lentiviral vector transduction, 2 × 10⁶ MB49 cells were seeded into 6‐well plates, and transduction was performed when cells were 30%‐50% confluent. Briefly, negative control or OPRM1‐Lentivirus (multiplicity of infection = 20 for both) and 8 μg/ml Polybrene (Beyotime) were added to MB49 cells together into fresh DMEM + 10% FBS. After incubation for 24 h, infected cells were cultured in a selection medium containing 3 μg/mL puromycin. Stably silenced OPRM1 MB49 cells (MOR‐KD MB49 cell) were then maintained in DMEM with 0.6 μg/mL puromycin.

Wang X., Zhang S., Jin D., Luo J., Shi Y., Zhang Y., Wu L., Song Y., Su D., Pan Z., Chen H., Cao M., Yang C., Yu W, & Tian J. (2023). μ‐opioid receptor agonist facilitates circulating tumor cell formation in bladder cancer via the MOR/AKT/Slug pathway: a comprehensive study including randomized controlled trial. Cancer Communications, 43(3), 365-386.

+ Open protocol

+ Expand

Adenovirus-Mediated RRM2 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded in a 6-well plate. Polybrene (4 µg/ml; Beyotime Institute of Biotechnology) was added, followed by RRM2-overexpressing recombinant adenovirus labeled with green fluorescence protein (AdRRM2; cat. no. GOSA0296619; Shanghai GeneChem Co., Ltd.) and negative control adenovirus labeled with green fluorescence protein (AdGFP; cat. no. ADCON267; Shanghai GeneChem Co., Ltd.) according to the manufacturer's standard protocol when cell confluence reached ~40%. After transfection at 37˚C for 8-12 h, the medium was changed to OM. Green fluorescence was observed and images were captured 24 h after treatment using a fluorescence microscope (Olympus IX53; Olympus Corporation; magnification, x100). siRRM2 was purchased from Shanghai GeneBio Co., Ltd. The sequences of siRRM2 were: Forward, 5'-GAGUACCAUGAUAUCUGGCAGAUGU-3' and reverse, 5'-ACAUCUGCCAGAUAUCAUGGUACUC-3'. According to the manufacturer's recommended protocol, siRRM2 was configured as a working system with an ultimate concentration of 20 µM and cells were transfected using Lipo8000 Transfection Reagent (cat. no. C0533; Beyotime Institute of Biotechnology) when cell confluence reached ~40%. In the control group, only Lipo8000 was added without siRRM2. Subsequent experimentation was performed after transfection with recombinant adenovirus or siRNA for at least 2 days.

Cai H., Guo H., Deng Y., Jiang J., Liu S., He W, & Jian H. (2022). RRM2 regulates osteogenesis of mouse embryo fibroblasts via the Wnt/β‑catenin signaling pathway. Experimental and Therapeutic Medicine, 24(4), 605.

+ Open protocol

+ Expand

Lentiviral-Mediated LMNA Manipulation in HCC Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The LMNA plasmid was purchased from Sino Biological (Beijing, China). The LMNA gene was then subcloned and inserted into a PLVX-puro lentivirus vector (Clontech, Shiga, Japan). The PLVX-shRNA1 lentivirus plasmid for LMNA shRNA was constructed as previously described [35 (link)]. The LMNA shRNA sequence was as follows: 5′-CTGACTTCCAGAAGAACA-3′. Lentivirus lacking the shRNA insert was used as a control.
To establish LMNA knockdown or overexpression of LMNA cells, 293T cells were transfected with the target plasmid along with psPAX2 and PMD2G packing plasmids with Lipo8000 Transfection Reagent (Beyotime, Shanghai, China, C0533). Next, 293T cell supernatants were collected and mixed with fresh medium to infect HCC827 or HCC827/ER cells along with 2 μg/mL polybrene (Beyotime, C0351). After 24 h, the supernatants were replaced with fresh medium containing puromycin (Beyotime, ST551) at a concentration of 5 μg/mL. The puomycin-resistant cells were isolated and used for further experiments.

Hu C., Zhou A., Hu X., Xiang Y., Huang M., Huang J., Yang D, & Tang Y. (2022). LMNA Reduced Acquired Resistance to Erlotinib in NSCLC by Reversing the Epithelial–Mesenchymal Transition via the FGFR/MAPK/c-fos Signaling Pathway. International Journal of Molecular Sciences, 23(21), 13237.

+ Open protocol

+ Expand

Genetic Manipulation of HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmids that contained wild-type vector (PCDH-CMY-MCS-EF1-Puro) and constitutive overexpression cDNA (NAMPT or NMNAT1) were constructed by Genewiz (Genewiz, Suzhou, China) through amplification, purification, and sequencing (Supplementary Materials). HEK293T cells (from Professor Qingquan Li, Department of Pathology at the School of Basic Medical Sciences, Fudan University) were cultured under standard conditions in the Dulbecco’s modified eagle’s medium (DMEM, Thermo Gibco, Waltham, MA, USA) supplemented with 10% bovine serum (Thermo Gibco, Waltham, MA, USA). For transfection, HEK293T cells were plated so that they reached 60–80% confluence and were transfected using Lipofectamine 2000 reagent (Invitrogen, Waltham, MA, USA). The virus solution was collected once every 24 h and 48 h, then filtered with a filter and mixed with 100 mg/mL Polybrene (Beyotime, Shanghai, China) at a ratio of 1:1000, and added to the culture solution of 50% target cells for 8–12 h and changed the fresh culture medium. The transfected MSC were screened with 1.5–2.5 μg/mL puromycin (Beyotime, Shanghai, China) after transfection for 48 h.

Li X., Li Y., Li F., Chen Q., Zhao Z., Liu X., Zhang N, & Li H. (2022). NAD+ Anabolism Disturbance Causes Glomerular Mesangial Cell Injury in Diabetic Nephropathy. International Journal of Molecular Sciences, 23(7), 3458.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!