For all drug treatments, embryos were collected from pair-wise or group mating, debris and unfertilized eggs were removed, and embryos were incubated in a 96-well plate containing 100 µl of drug solution. IWR solutions were prepared by dissolving 5 mg of IWR (Sigma-Aldrich) in 1.22 ml DMSO (Sigma-Aldrich) and then diluting this solution in fish water (0.3 g/l Instant Ocean Sea Salt, Pentair, Apopka, USA) with or without 30 mg/l phenylthiourea (Sigma-Aldrich). Embryos were incubated at a final concentration of 10 µM of IWR or vehicle solution starting at 4 hpf until fixation or RNA isolation. LiCl solutions were prepared by diluting LiCl (Sigma-Aldrich) in fish water with or without 30 mg/l phenylthiourea (Sigma-Aldrich). Embryos were incubated in a 0.3 M solution of LiCl or fish water at various time points.
Phenylthiourea
Manufactured by Merck Group
Sourced in United States
Phenylthiourea is a chemical compound used in various laboratory applications. It serves as a reagent and can be used in analytical procedures. The specific core function of phenylthiourea is to act as a sensitive indicator for the detection of certain elements or compounds in analytical testing.
Automatically generated - may contain errors
Lab products found in correlation
Dimethyl sulfoxide (dmso), by Merck Group (4 mentions)
Ms 222, by Merck Group (3 mentions)
2 phenoxyethanol, by Fujifilm (2 mentions)
Tricaine, by Merck Group (2 mentions)
Axiocam digital camera, by Zeiss (2 mentions)
Dimethyl sulfoxide (dmso), by Nacalai Tesque (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Carbopacma1, by Thermo Fisher Scientific (1 mentions)
Biolc, by Thermo Fisher Scientific (1 mentions)
Trypsin solution, by Promega (1 mentions)
Rapigest sf, by Waters Corporation (1 mentions)
Peptide calibration standard 2, by Bruker (1 mentions)
Protein calibration standard 1, by Bruker (1 mentions)
1 4 dithiothreitol, by Merck Group (1 mentions)
Milli q water, by Merck Group (1 mentions)
Phenylmethylsulfonyl fluoride, by Merck Group (1 mentions)
Ammonium bicarbonate, by Merck Group (1 mentions)
Methanol, by Carlo Erba (1 mentions)
Acetonitrile, by Carlo Erba (1 mentions)
Ethanol, by Carlo Erba (1 mentions)
61 protocols using phenylthiourea
1
Embryo Manipulation with IWR and LiCl
2
Zebrafish Embryo Maintenance and Staging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zebrafish were maintained and bred at 26.5°C, and embryos were raised at 25°C-32°C and staged as described previously (Kimmel et al., 1995 (link)) in hours post fertilization (hpf). Embryos were treated with 0.003% phenylthiourea (Sigma) from 20 to 48 hpf and 0.005% phenylthiourea (Sigma) from 48 hpf until the end of the experiment to prevent pigmentation, and were anaesthetized using 0.04% MS-222 (Sigma) prior to mounting.
3
Generating Germ-line trβ2 Mutations in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Germ-line mutations of trβ2 were generated by Cas9 mRNA and trβ2-gRNA co-injections into the one-cell stage embryos of Tg(thrb2:tdTomato)q22 or Tg(thrb:MA-YFP)q23 according to the method described previously [34 ]. The targeting sequence is 5’-GGCAACACAGCCAACCCTAT-3’ which resides in the first exon of trβ2, the only exon not shared by trβ1. Between 12 hpf and 4 dpf the injected embryos were raised in 300 μM Phenylthiourea (PTU, Sigma-Aldrich, catalogue P7629) to block melanin synthesis. At 4dpf, larvae with weak mosaic fluorescent expression of tdTomato or YFP in the photoreceptor layer were screened as potential carriers of germ-line mutations of trβ2 and raised. The carriers of germ-line mutation of trβ2 were identified by in-crossing the potential carriers. The rationale was that trβ2 mutants might have a fluorescence phenotype, as trβ2 was thought to be a self-activating gene. Suspected mutant lines were in-crossed for multiple generations. To sort the fluorescence phenotypes, larvae were raised in 300 μM Phenylthiourea (PTU, Sigma-Aldrich, catalogue P7629). At the age of 4 dpf larvae were anesthetized in a 3.5-inch Petri dish with ~0.5 ml of Tris buffered 0.4% tricaine in 45 ml of egg water before sorting based on fluorescence in the eye’s photoreceptor layer.
4
Zebrafish Embryo Maintenance and Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type zebrafish embryos were obtained from the zebrafish facility at the Faculty of Medicine, University of Oslo, Norway, and at the Norwegian University of Life Sciences, Oslo, Norway. Zebrafish embryos were kept at 28.5°C in embryo water supplemented with 0.003% phenylthiourea (Sigma-Aldrich) to inhibit melanization, and water was changed daily for the duration of the experiment. Experiments using zebrafish embryos and larvae were conducted in agreement with the provisions enforced by the national animal research authority at the Norwegian Food Safety Authority (Mattilsynet).
5
Trehalose Quantification in Larval Hemolymph
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hemolymph was collected after cutting the first abdominal prolegs of mutant L5 larvae. A few phenylthiourea (Sigma-Aldrich Korea, Seoul, South Korea) granules were added to the hemolymph sample to prevent coagulation. After centrifugation at 400 × g for 3 min, the supernatant plasma was diluted 20× with distilled water. The diluted plasma sample was cleaned with a Sep-Pak C18 cartridge (Walters Associates, Milford, MA, United States). Trehalose was identified and quantified using high-performance liquid chromatography (HPLC) (BioLC, Dionex, Sunnyvale, CA, United States) with the main column (CarboPacMA1, 4 × 250 mm, Dionex) and a guard column (CarboPacMA1, 4 × 50 mm, Dionex) following the method described by Park and Kim (2013) (link). The injection volume of the sample was 25 μL. NaOH (400 mM) was used as an elution buffer at a constant rate of.4 mL/min. Pulse amperometry mode of an electrochemical detector (ED40, Dionex) was used for detecting trehalose and other sugars.
6
Zebrafish Embryo Maintenance and Pigment Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult zebrafish (Danio rerio) and embryos of the Tübingen longfin and AB strains were maintained at ∼28.5°C and staged according to Westerfield (1995) . Embryos were raised in E3 embryo medium (Westerfield, 1995 ) with 0.003% phenylthiourea (Sigma-Aldrich) to inhibit pigment formation.
7
Mass Spectrometry Sample Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For sample preparation and analysis, acetonitrile (ACN) and trifluoroacetic acid (TFA), methanol, and ethanol of LC-MS grade quality or higher were obtained from Carlo Erba Reagents (Val de Reuil, France). For MALDI mass spectrometer calibration, two calibration kits Peptide Standard Calibration II and Protein Standard Calibration I from Bruker Daltonics (Bremen, Germany) were used. Ammonium bicarbonate (ABC), 1,4-dithiothreitol (DTT), 4-vinyl-pyridin (4-VP), phenylthiourea as melanisation inhibitor (PTU), phenylmethylsulfonyl fluoride (PMSF) as protease inhibitor, and alpha-cyano-4-hydroxycinnamic acid (4-HCCA) matrix were from Sigma-Aldrich (St. Louis, MO, USA). Trypsin solution was purchased from Promega. RapiGest™ SF was purchased from Waters. Ultrapure water (MilliQ water; Millipore, Billerica, MA, USA) was used.
8
Zebrafish Husbandry and Embryo Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adult zebrafish (Danio rerio) were maintained in our facility on a 14–10 light–dark cycle in circulating water at 26–28°C. Embryos of either sex were raised at 28.5°C in E3 embryo medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, and 0.33 mM MgSO4). Embryos to be collected for imaging were treated with 0.003% phenylthiourea (Sigma-Aldrich, St. Louis, USA) in E3 to prevent pigmentation. Embryos were staged by time after fertilization. All handling procedures were approved by the local ethical review committee at Nanchang University.
9
Zebrafish Embryo Collection and Pigmentation Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The zebrafish lines TU and Tg (kdrl:EGFP) were obtained from the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, and maintained at 26–28°C with 14/10 h light/dark cycles in an automatic zebrafish housing system (Haisheng, Shanghai, China) as described previously (Westerfield, 1993 ). Zebrafish were fed twice daily with live brine shrimp. For embryos collection, one male and one female zebrafish were separated in a spawning box overnight, and spawning was triggered by the light on the next morning. Embryos were collected within 30 min and then maintained at 28.5°C. To inhibit pigmentation, embryos were incubated in embryo medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4, and 0.002% methylene blue) containing 0.003% phenylthiourea (Sigma-Aldrich, St. Louis, MO, United States).
10
Whole-Mount In Situ Hybridization for Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zebrafish embryos were obtained at various stages of growth and fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS; pH 7.4; Invitrogen Life Technologies, Carlsbad, CA, USA) overnight at 4°C. After three rinses with PBS, we transferred the embryos into 100% methanol and stored them at −20°C until use. All embryos were treated with 0.003% phenylthiourea (Sigma, St. Louis, MO, USA) to prevent melanogenesis in the skin. Whole-mount in situ hybridisation was performed to identify zlum mRNA by using a previously described protocol [40 (link)]. The oligonucleotide sequence (5′-3′) was GTTTCCATCCAAGCGCAGGGTCCTCAGTCTAGAGTAGTTGACCGGTGAGCTAAATCTGCA. The hybridisation signals were visualised with anti-digoxigenin antibody conjugated with alkaline phosphatase by using a procedure recommended by Roche Applied Science (Indianapolis, IN, USA). Images were obtained using an AxioCam digital camera on a dissecting microscope (Zeiss, Germany).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!