Green safe premium nucleic acid stain

Fungi-specific PCR reactions were carried out using forward primer ITS1F CTTGGTCATTTAGAGGAAGTAA [28 (link)] and reverse primer ITS2 GCTGCGTTCTTCATCGATGC [29 ], producing amplicons of 320 bp using a protocol modified from [30 (link)]. PCR reactions were carried out in 25 μL total reaction volume using 2X Master Mix (New England Biolabs, Ipswich Massachusetts, MA, USA), 0.4 mM oligonucleotide primers synthesised by Eurofins (Ebersberg, Germany), 1 μL DNA (ca. 50–200 ng/μL) and performed on a BioRad T100 PCR thermal cycler. Cycling conditions were as follows: 95 °C for 2 min, followed by 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and finalised by 10 min elongation at 72 °C. Products derived from PCR were visualised on a 2% agarose/TBE gel with GreenSafe premium nucleic acid stain (NZYTech, Portugal). Sanger sequencing was performed using both forward and reverse primers synthesised by Source BioScience (Nottingham, UK) and Eurofins. Sequences were deposited in GenBank under accession numbers MT000100-MT000103.

DNA concentration and purity were estimated using DeNovix DS-11 FX (DeNovix Inc., Wilmington, United States). The concentration of extracted DNA was assessed by measuring the absorbance of the samples at A260 nm. Quality/purity was determined by analysing the A₂₆₀/A₂₈₀ ratio. DNA integrity was evaluated by electrophoresis in a 0.8% (w/v) agarose gel (NZYtech, Lisboa, Portugal) in 1 × TAE buffer (Tris-acetate-EDTA) (NZYtech, Lisboa, Portugal) stained with Green®Safe Premium nucleic acid stain (NZYtech, Lisboa, Portugal), and visualized under UV light using a Gel Doc XR+ (Bio-Rad Lab, Hercules, United States) and Quantity One software^®.

To validate the presence of amplifiable DNA in all samples, a species-specific PCR targeting the mitochondrial D-loop region producing a fragment of approximately 531 bp was performed using the respective set of forward and reverse primers sequences: FW 5′-AAC CCT ATG TAC GTC GTG CAT-3′ and RV 5′- ACC ATT GAC TGA ATA GCA CCT-3’ (Montiel-Sosa et al., 2000 (link)). The PCR reactions were performed in a final volume of 25 μL, containing 2 × NZYTaq II Green Master Mix (NZYtech, Lisboa, Portugal), 0.25 μM of each primer and 20 ng/μL of DNA. A negative and positive control was included in each assay. The reactions were incubated at 95°C for 5 min; followed by 35 cycles of 95°C/30 s, 50°C/30 s, 72°C/30 s, and a final 10 min of extension at 72°C. All runs included internal positive (swine sausage) and negative (fennel leaf) controls. All amplifications steps were performed on a Veriti™ Dx 96-well Thermal Cycler (Thermo Fisher Scientific, Massachusetts, United States). PCR products were separated by electrophoresis in 1.5% agarose gel in 1 × TAE buffer (Tris-acetate-EDTA) (NZYtech, Lisboa, Portugal) stained with Green®Safe Premium nucleic acid stain (NZYtech, Lisboa, Portugal).