All strains used for experiments conducted in this study were derivatives of Escherichia coli K-12 MG1655. Cloning reactions were executed in MC1061 or NEB5α (New England Biolabs). All strains are listed in Table 1 . All plasmids used in this study are listed in Table 2 . All oligonucleotides used for polymerase chain reaction (PCR)-mediated genetic engineering, PCR screening, or Northern blot analysis are listed in Table 3 . λ-Red recombineering reactions to gene fusions were executed in strain PM1800. PM1800 has a cat-sacB cassette inserted in the lac locus and encodes the λ-Red proteins (gam, exo, and beta) on a partial lambda vector marked with tetracycline resistance (mini-λ:tet). Plasmids from the small RNA library or their respective mutants were transformed into the PBAD-rseA27-lacZ translational fusion strain using TSS transformation (Chung et al., 1989 (link)). Mutations were transduced into reporter fusion strains using Bacteriophage P1 transduction.
Neb5α
Manufactured by New England Biolabs
Sourced in United States, Germany
NEB5α is an Escherichia coli strain used for routine cloning and plasmid DNA propagation. It is a high-efficiency competent cell line that supports blue/white color screening for recombinant plasmids.
Automatically generated - may contain errors
Lab products found in correlation
Bl21 de3, by New England Biolabs (3 mentions)
Neb10β, by New England Biolabs (3 mentions)
Bl21 de3, by Thermo Fisher Scientific (3 mentions)
M15prep4, by Qiagen (2 mentions)
Lb broth, by Merck Group (2 mentions)
Stellar, by Takara Bio (2 mentions)
Jm109, by Promega (2 mentions)
Top10, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Gibson assembly cloning kit, by New England Biolabs (1 mentions)
Q5 high fidelity 2x master mix, by New England Biolabs (1 mentions)
Instant sticky end ligase master mix, by New England Biolabs (1 mentions)
Dpni, by New England Biolabs (1 mentions)
T4 polynucleotide kinase, by New England Biolabs (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Pyes dest52, by Thermo Fisher Scientific (1 mentions)
Bl21 star de3, by Thermo Fisher Scientific (1 mentions)
In fusion cloning, by Takara Bio (1 mentions)
E coli top10, by Thermo Fisher Scientific (1 mentions)
Zr plasmid miniprep classic kit, by Zymo Research (1 mentions)
37 protocols using neb5α
1
Cloning and Genetic Engineering in E. coli K-12
2
Construction of Engineered hCNTF Fusion Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The construction of pOPIN-fusion vector backbones has been described elsewhere [51 –53 (link)]. The complete coding sequence of hCNTF was synthesized by GenScript, NJ, USA and provided as an insert within pUC57 plasmid. hCNTF gene was amplified by polymerase chain reaction (PCR) using KOD Hot Start (Novagen) with primers that had 5’-extensions of AAGTTCTGTTTCAGGGCCCG and ATGGTCTAGAAAGCTTTA on the forward and reverse primers, respectively (Additional file 1 : Figure S1). The set of nine vectors harboring various fusion tags is listed in Table 1 . The purified PCR product was inserted into digested pOPIN vectors between KpnI and HindIII restriction sites using Gibson Assembly™ cloning kit (New England Biolabs, MA, USA) and the reaction mixture transformed into NEB 5α (New England Biolabs, MA, USA) competent cells. Three colonies were screened for each construct and the presence of insert verified by PCR using a vector specific forward primer and hCNTF gene specific reverse primer (Additional file 1 : Figure S2). pOPIN expression vectors 6-His-(fusion tag)-hCNTFs obtained were (6-His)-hCNTF, 6-His-(S3C)-hCNTF, 6-His-(Trx)-hCNTF, 6-His-(MSYB)-hCNTF, 6-His-(J)-hCNTF, 6-His-(HALO)-hCNTF, 6-His-(M)-hCNTF, 6-His-(TF)-hCNTF, 6-His-(NusA)-hCNTF.
3
Engineered E. coli Strains for Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All protein expression was done in strains derived from E. coli C321.A fimBE::tolC (strain A), where fimBE genes were deleted using λ-red recombination by replacing them with a tolC cassette. E. coli C321.A fimA::gent (strain B) was created by deleting fimA with gentamycin using λ-red recombination. fimA mutants in the fimBE::tolC background were created using multiplex automated genome engineering (MAGE)31 (link). E. coli strain NEB5α was used for cloning and plasmid assembly (New England Biolabs).
4
Bacterial Expression and Purification of Vluc Luciferase
5
E. faecalis V19 Strain Cultivation and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reference strain used in this study is E. faecalis V19, which corresponds to a plasmid-cured strain derived from the V583 strain of clinical origin (Paulsen et al., 2003 (link)). Overnight cultures were achieved in M17 medium supplemented with 0.5% glucose (GM17). Escherichia coli strains TOP10 (ThermoFisher, Waltham, MA, United States), NEB-5α (New England BioLabs, Ipswich, MA, United States), and M15 pRep4 (Qiagen, Hilden, Germany) were used for RNA in vitro production, mutant constructions, and recombinant protein synthesis, respectively. Media were supplemented with chloramphenicol (Cm 10 μg/ml), kanamycin (Kan 50 μg/ml), or ampicillin (Amp 100 μg/ml) when needed (Supplementary Table 1 ).
6
Plasmid Mutagenesis via PCR and Ligation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutations, insertions, and deletions were incorporated or removed via PCR using Q5 High-Fidelity 2X Master Mix according to the manufacturer’s instructions (New England BioLabs) and primers listed in Supplementary Table S2 with the pNK25 plasmid as the starting template in 10-μl volume reactions. PCR products were visualized on 0.8% agarose to confirm size and successful amplification and subsequently purified using Qiagen QIAquick PCR Purification Kit. The plasmid template was removed using DpnI (New England BioLabs), then the 3′ ends of the PCR products were phosphorylated using T4 Polynucleotide Kinase (New England BioLabs) and ligated with Instant Sticky-end Ligase Master Mix (New England BioLabs) prior to transformation into chemically competent NEB5α (New England BioLabs). Transformants were selected on LB agar containing 100 μg/ml ampicillin (Amp100). Colonies were picked for overnight cultures for plasmid miniprep and then sent for Sanger sequencing.
7
Recombinant DNA in E. coli and P. pastoris
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
8
Cultivation of Escherichia coli and Zymomonas mobilis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli strain NEB5α (New England Biolabs Inc, USA) was used for plasmid construction and maintenance and was cultivated in LB media (10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl) at 37 °C. Z. mobilis wild type strain ZM4 (ATCC 31821) was used for the construction of sGB027. Z. mobilis pre-cultures as well as cultures and plates for strain construction were cultivated in Zymomonas complex medium (ZCM; bacto peptone 10 g/L, yeast extract 10 g/L, glucose 20 g/L; DSMZ GmbH) at 30 °C in closed flasks. Seed and main cultures were cultivated in Zymomonas minimal medium (ZMM) containing 1 g/L K2HPO4, 1 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4SO4, 0.2 g/L MgSO4·7H2O, 25 mg/L Na2MoO4·2H2O, 2.5 mg/L FeSO4·7H2O, 20 mg/L CaCl2·2H2O, 2 g/L Ca(HCO3)2, 1 mg/L calcium pantothenate, 20 g/L glucose (modified from [19 (link)]). If necessary, 100 µg/L kanamycin or 200 µg/L spectinomycin were added.
9
E. coli-based B3H Assay for RNA-Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli strains, plasmids and oligonucleotides used in the B3H assay are listed in Suppl. Tables S2 –S4 . NEB5α, purchased from New England Biolabs, was the recipient strain for all cloned B3H plasmids. KB473 served as the reporter strain for all β-galactosidase (β-gal) assays. Each strain and plasmid has specific antibiotic resistance gene(s), listed with the following abbreviations: AmpR (ampicillin and carbenicillin), CmR (chloramphenicol), KanR (kanamycin), StrR (streptomycin), and TetR (tetracycline). All strains were stored as glycerol stocks at −80°C.
In this B3H system, plasmids express three hybrid components: 1) a DNA-RNA adapter protein, CI-MS2CP, tethers 2) a Bait RNA construct upstream of a test promoter such that it is available for interaction with 3) an RNA Polymerase (RNAP)-tethered prey protein (Fig 1A ). Reporter cells encode a lacZ reporter gene downstream of a test promoter on a single-copy F′ episome. Transformation of reporter cells with all three plasmids (pPrey, pAdapter, and pBait) leads to a boost in β-gal levels relative to basal levels indicated by three negative controls in which half of each hybrid component is left out (Fig 1B ); the strength of an RNA-protein interaction correlates to the fold-stimulation in β-gal activity over basal levels when all components are present (Fig 1C ; (Wang et al. 2021 (link); Stockert et al. 2022 (link))).
In this B3H system, plasmids express three hybrid components: 1) a DNA-RNA adapter protein, CI-MS2CP, tethers 2) a Bait RNA construct upstream of a test promoter such that it is available for interaction with 3) an RNA Polymerase (RNAP)-tethered prey protein (
10
Cultivating Diverse Microbial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli strains DH5α [43 (link)], NEB5α (New England Biolabs), J53 [44 (link)] and S17-1 [45 ], used for cloning and conjugation, respectively, were cultivated on LB-agar plates or in liquid LB medium (Luria/Miller, Carl Roth) at 37 °C. Antibiotics were added to E. coli culture medium to the following final concentrations [μg mL-1]: 100 (ampicillin), 50 (kanamycin), 20 (spectinomycin). The photosynthetic purple non-sulfur α-proteobacterium R. capsulatus SB1003 [46 (link)] was cultivated on 2% (w/v) agar (Bacto agar; Difco) containing PY plates [47 (link)] or in RCV liquid medium [48 (link)] at 30 °C. The non-motile, glucose-tolerant (GT) strain of Synechocystis sp. PCC 6803 as well as the corresponding mutant strain Δshc (slr2089) used in this study were kindly provided by Pia Lindberg (Uppsala University, Sweden) and cultivated on 0.75% (w/v) agar (Bacto agar; Difco) plates containing BG-11 mineral medium or in BG-11 liquid medium [49 ] at 30 °C. Saccharomyces cerevisiae strain GIL77 (gal2 hem3-6 erg7 ura3-167) [50 (link)], carrying derivatives of vector pYES/DEST-52 (Invitrogen) with MRN1 or THAS1, or as empty vector control [51 (link)], were cultivated at 30 °C using synthetic complete medium without uracil, supplemented with glucose, ergosterol, hemin, and Tween, as previously described [52 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!