A1720

In order to validate that the phenotypic changes noted with STRAP KO cells were not secondary to off-target effects of the CRISPR-Cas9 system, we performed rescue experiments by transfecting AS STRAP KO cells with c-Flag pc-DNA empty vector (EV) or pc-DNA STRAP plasmid [13 (link)]. STRAP KO cells (3 × 10³) were plated in 6-well plates and transfected with either FuGENE^® HD, FuGENE^® HD and EV plasmid, or FuGENE^® HD and STRAP plasmid for 72 h. Stable rescue cells were selected and maintained in AS media with the addition of G418 (600 µg/mL, A1720, Sigma-Aldrich). Cells were used in proliferation studies with CellTiter 96^® assay as described below to examine the phenotype of the KO cells following the re-introduction of STRAP.

The SND1 knockout SW480 cell line was established using a double small guide RNA (gRNA) strategy. The target sites were chosen using a CRISPR gRNA design tool (http://crispor.tefor.net/, accessed on 10 October 2018) and two guides were selected, GGTGCGCCATCATTGTCCG and AACGGTTCACATACTATCC, targeting SND1 exon 2 and exon 5, respectively. For SND1 knockout in the HEK-293T cells the GTAGAAAACAAGACTCCCCAG guide RNA was used. Control HEK-293T clones were generated using the GTAGAATACAACACTCGCCAG guide RNA having three base substitutions (underlined) as compared to the SND1-targeting guide RNA. gRNA_Cloning Vector was a gift from George Church (Addgene plasmid # 41824) [30 (link)], and pCas9_GFP was a gift from Kiran Musunuru (Addgene plasmid # 44719) [31 (link)]. Subsequently, cells were transfected with both plasmids and cultivated in normal growth medium supplied with neomycin (1 mg/mL 5–7 days) (A1720, Sigma-Aldrich, Saint Louis, MO, USA). Growing clones were isolated and genotyped with PCR and Western blot for SND1.