Superscript 2 rt enzyme

Manufactured by Roche

Superscript II RT enzyme is a reverse transcriptase enzyme used in the synthesis of complementary DNA (cDNA) from RNA templates. It is a reliable and efficient tool for various RNA-based applications, including gene expression analysis, cDNA library construction, and first-strand cDNA synthesis.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions) Mgb taqman probes, by Thermo Fisher Scientific (1 mentions) Sybr green, by Roche (1 mentions) Sybr green method, by Roche (1 mentions) Taqman probe, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

Superscript II (12 citations)

3 protocols using superscript 2 rt enzyme

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression was performed by real time PCR as previously described (Ballabh et al. 2007 (link)). Briefly, total RNA was isolated using a RNeasy Mini kit (catalog #74104, Qiagen) from a coronal brain slice taken at the level of the mid-septal nucleus. cDNA was synthesized using Superscript II RT enzyme (catalog # 05081955001, Roche, Indianapolis, IN) followed by real time quantitation using SYBR green (catalog # 04913850001, Roche, Indianapolis, IN) with an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). Analysis was completed using the efficiency corrected ΔΔCT method. The following primers were used: GFAP (accession number: NG_008401) sense: ACTCAATGCTGGCTTCAAGGAGAC, antisense: ATGTAGCTGGCAAAGCGGTCATTG. The gene expression for EGFR1 (Assay ID: OC 33955872_g1), EGFR2 (Assay ID: OC04096730_m1), EGFR3 (Assay ID:OC03395874_m1), EGFR4 (Assay ID: OC 03395876_m1), Sox9 (Assay ID: Oc04096872_m1), NFIA (Assay ID: Hs00325656_m1) were assayed using primers plus MGB TaqMan probes from Life Technologies (Norwalk, CT).

Vinukonda G., Hu F., Mehdizadeh R., Dohare P., Kidwai A., Juneja A., Naran V., Kierstead M., Chawla R., Kayton R, & Ballabh P. (2016). Epidermal Growth Factor Preserves Myelin and Promotes Astrogliosis after Intraventricular Hemorrhage. Glia, 64(11), 1987-2004.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA expression was performed by real‐time PCR as previously described. 14, 20, 33 Briefly, total RNA was isolated using an RNeasy Mini kit (catalog # 74104, QIAGEN) from a coronal brain slice taken at the level of the mid‐septal nucleus. cDNA was synthesized using Superscript II RT enzyme (catalog # 05081955001, Roche, Indianapolis, IN) followed by real‐time quantification using SYBR green method (catalog # 04913850001, Roche). The same primer sets were used as described previously. 14, 33 Analysis was completed using the efficiency corrected ΔΔCT method and the data were presented in percentages. 34

Vinukonda G., Liao Y., Hu F., Ivanova L., Purohit D., Finkel D.A., Giri P., Bapatla L., Shah S., Zia M.T., Hussein K., Cairo M.S, & La Gamma E.F. (2019). Human Cord Blood‐Derived Unrestricted Somatic Stem Cell Infusion Improves Neurobehavioral Outcome in a Rabbit Model of Intraventricular Hemorrhage. Stem Cells Translational Medicine, 8(11), 1157-1169.

+ Open protocol

+ Expand

Quantifying Gene Expression via Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression was quantified by real time PCR, as described previously (Ballabh et al., 2007 (link)). Briefly, total RNA was isolated using a RNeasy Mini kit (catalog #74104, Qiagen) from a coronal brain slice taken at the level of the mid-septal nucleus. cDNA was synthesized using Superscript II RT enzyme (catalog # 05081955001, Roche, Indianapolis, IN) followed by a real-time quantitation using an ABI Prism 7900HT detection system. TaqMan probes were bought from Life technologies. Their assay IDs were as follows: GAPDH (Oc03823402_g1), TNFα (Oc03397716_g1), IL1β (Oc03823250_s1), CNTF (Oc03397817_m1), LIF (Hs01055668_m1), IL-6 (Oc04097053_m1), Hes 5 (Mm00439311_g1), Hes 1 (APH49WG), GSk3b(Hs01047719_m1).

Dohare P., Cheng B., Ahmed E., Yadala V., Singla P., Thomas S., Kayton R., Ungvari Z, & Ballabh P. (2018). Glycogen synthase kinase-3β inhibition enhances myelination in preterm newborns with intraventricular hemorrhage, but not recombinant Wnt3A. Neurobiology of disease, 118, 22-39.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!