Tissue samples of the testis and oviduct from Finnish Large White pigs were collected at slaughter. The dataset contains samples of ISTS-affected and control animals. Previously, we have studied the effect of ISTS on gene expression within the ISTS-associated region (Sironen et al. 2006 (link), 2007 (link), 2014 (link)), and we have shown that only the expression of SPEF2 and PRLR are affected. At slaughter, sows were approximately 4.5 months old and had not been bred. Boars were mature and had been used for breeding. The oviduct and testis tissue samples were collected in RNAlater buffer (Qiagen) and stored at −80°. For RNAseq analysis, four samples were used: the oviduct from an ISTS homozygous sow and a control sow, and the testis from an ISTS homozygous boar and a control boar. For RT-PCR, additional samples of two ISTS and control sows and boars were collected.
Rnalater buffer
Manufactured by Qiagen
Sourced in Germany
RNAlater buffer is a solution designed to rapidly stabilize and protect RNA in biological samples, preventing degradation. It is formulated to preserve the RNA integrity during sample collection, storage, and transportation, allowing for accurate downstream analysis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy kit, by Qiagen (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Kapa rna hyperprep kit with riboerase, by Roche (2 mentions)
Nextflex dna barcode, by PSC Biotech (2 mentions)
High sensitivity dna bioanalyzer kit, by DeNovix (2 mentions)
Dsdna high sensitivity assay, by DeNovix (2 mentions)
Nextseq 500, by Illumina (2 mentions)
Dnase 1, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Sybr green 1, by Evrogen (1 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (1 mentions)
Mmlv rt kit, by Evrogen (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rneasy lipid tissue mini kit, by Qiagen (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Agilent bioanalyzer, by Agilent Technologies (1 mentions)
Opticon system, by Bio-Rad (1 mentions)
Omniscript reverse transcription kit, by Qiagen (1 mentions)
37 protocols using rnalater buffer
1
Transcriptomic Analysis of ISTS in Pigs
2
Genetic Diversity of Baung Catfish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Baung fish DNA was obtained from 28 samples of the epaxial and hepaxial muscles of fish from various rivers in Indonesia and from the Indian Ocean. Table-1 shows the origin, number, and code of the baung fish. All individuals were identified based on morphological characteristics and sample tissues were preserved in RNAlater buffer (Qiagen). The catfish samples in this study were considered to be unrelated genetically because they were taken individually from the rivers and ocean. Catfish were collected from the ocean to determine the relationship and genetic diversity between river catfish and sea catfish.
3
Dietary Modulation of Hepatocarcinoma in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57Bl/6 male mice were obtained from the Centro de Investigaciones Biológicas (CIB-CSIC) (Madrid, Spain). To induce hepatocarcinoma (Ethic code, Proex 220/17), the animals were randomly distributed into four different groups (n = 6 per group) under a standard (groups 1 and 2) or a high-fat diet (groups 3 and 4) (AIN93G mod. HF 43 kcal% fat, irradiated, Ssniff spezialdiäten gmbh): groups 1 and 3 received a saline solution as the ‘vehicle’ (control); groups 2 and 4 received SETIs (reconstituted lyophilisates).
HCC was induced by a combined treatment with diethynitrosamine (DEN)/thioacetamide (TAA) [3 (link),7 (link),8 (link)]: DEN (20 mg/kg, i.p.), given 3 times per week (for 2 weeks), and TAA (saturated solution—0.5 mL/kg i.g., dissolved in PBS—dose equivalent to 80 mg/kg) administered 3 times per week (for 8 weeks). The mice were sacrificed 7 weeks after the initial DEN injection (Figure 1 ).
Changes in body weight (BW) and food consumption were monitored every two days. After treatment, the mice were sacrificed by cervical luxation. Whole blood samples were preserved in EDTA-treated tubes (at room temperature) for analyses. Different sections (30–50 mg) of the liver were immersed in RNA later buffer (Qiagen, Hilden, Germany), Krebs’s buffer, and RIPA buffer and kept at −80 °C until analysis.
HCC was induced by a combined treatment with diethynitrosamine (DEN)/thioacetamide (TAA) [3 (link),7 (link),8 (link)]: DEN (20 mg/kg, i.p.), given 3 times per week (for 2 weeks), and TAA (saturated solution—0.5 mL/kg i.g., dissolved in PBS—dose equivalent to 80 mg/kg) administered 3 times per week (for 8 weeks). The mice were sacrificed 7 weeks after the initial DEN injection (
Changes in body weight (BW) and food consumption were monitored every two days. After treatment, the mice were sacrificed by cervical luxation. Whole blood samples were preserved in EDTA-treated tubes (at room temperature) for analyses. Different sections (30–50 mg) of the liver were immersed in RNA later buffer (Qiagen, Hilden, Germany), Krebs’s buffer, and RIPA buffer and kept at −80 °C until analysis.
4
Pediatric Eosinophilic Esophagitis Profiling
5
Urine Sample Processing for RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Urine sample processing was performed as described39 (link). The collected urine with prostate fluid was mixed with 5 ml RNAlater buffer (Qiagen) as an RNA stabilizing agent. RNA extraction was performed using the RNeasy Mini kit (Qiagen) according to manufacturer’s guidelines.
6
Oocyte Collection and Plasma Hormone Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice from each group were anesthetized with an i.p. injection of diazepam (5 mg/kg, Stesohid; Dumex, Copenhagen, Denmark) and ketamine (200 mg/kg, Sante Animale, Brussels, Belgium). Blood samples were collected from the left ventricle of the heart in a heparinized syringe. Plasma samples were obtained by centrifuging the blood samples at 3000 rpm for 10 min and then were stored at -80°C until E2 assays by the enzyme linked immunosorbent assay (ELISA) method. After the collection of blood samples, the mice from all the study groups were euthanized by i.p. injection of sodium pentothal (200 mg/kg). MII oocytes (at least 20) were collected from the oviducts of superovulated mice 16 hour after an hCG injection and were placed in RNAlater buffer (Qiagen, Hilden, Germany). Moreover, the ovarian tissues were taken from all the groups in experiments 1 and 2. One ovary from each animal was stored in 10% buffered neutral formalin for immunofluorescence analysis, and the other was stored in RNAlater buffer for quantitative real-time polymerase chain reaction (qPCR) studies. The tissues and oocytes in RNAlater buffer were stored at −80°C before RNA extraction.
7
Monocyte RNA Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA isolation 1∗106 isolated monocytes were resuspended in 350 μL of RNA later Buffer (QIAGEN). RNA was isolated using RNeasy kit (QIAGEN) including DNaseI (QIAGEN) digestions.
Total RNA isolated from monocytes was used for the preparation of the RNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (KAPA Biosystems). In short, oligo hybridization and rRNA depletion, rRNA depletion cleanup, DNase digestion, DNase digestion cleanup, and RNA elution were performed according to protocol. Fragmentation and priming were performed at 94°C for 6 min. First strand synthesis, second strand synthesis and A-tailing was performed according to protocol. For the adaptor ligation, a 1.5 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First and second post-ligation cleanup was performed according protocol. A total of 11 PCR cycles were performed for library amplification. The library amplification cleanup was done using a 0.8x followed by a 1.0x bead-based cleanup. Library size was determined using the High Sensitivity DNA bioanalyzer kit, and the library concentration was measured using the dsDNA High Sensitivity Assay (Denovix). Paired-end sequencing reads of 50 bp were generated using an Illumina NextSeq 500.
Total RNA isolated from monocytes was used for the preparation of the RNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (KAPA Biosystems). In short, oligo hybridization and rRNA depletion, rRNA depletion cleanup, DNase digestion, DNase digestion cleanup, and RNA elution were performed according to protocol. Fragmentation and priming were performed at 94°C for 6 min. First strand synthesis, second strand synthesis and A-tailing was performed according to protocol. For the adaptor ligation, a 1.5 μM stock was used (NextFlex DNA barcodes, Bioo Scientific). First and second post-ligation cleanup was performed according protocol. A total of 11 PCR cycles were performed for library amplification. The library amplification cleanup was done using a 0.8x followed by a 1.0x bead-based cleanup. Library size was determined using the High Sensitivity DNA bioanalyzer kit, and the library concentration was measured using the dsDNA High Sensitivity Assay (Denovix). Paired-end sequencing reads of 50 bp were generated using an Illumina NextSeq 500.
8
Skin Wound Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Skin fragments from the lesion area were placed in RNA-later buffer (QIAGEN, Venlo, Netherland), incubated for 1 day at +4 °C, and stored at −80 °C. Several skin fragments were taken to study gene expression. The skin fragment that was removed was used as a control. The area of damage was considered to be the immediate tissue inside the wound and a minimal amount of adjacent intact skin up to 1 mm wide outward from the wound edge. For each study term, material was sampled from 5 rats. Total RNA was isolated from the obtained samples using the RNeasy Fibrous tissue Mini Kit (QIAGEN, Venlo, Netherlands,). Synthesis of cDNA from the matrix of the obtained total RNA was performed using a ready-made reagent kit MMLV RT kit (Evrogen, Moscow, Russia). PCR was performed with the obtained cDNAs using ready-made qPCRmix-HS SYBR reagent kits containing fluorescent intercalating dye Sybr Green I (Evrogen, Moscow, Russia,). Primers for PCR were selected using the on-line program Primer-BLAST in accordance with generally accepted requirements. The selected primers (Table 1 ) were synthesized by Evrogen (Moscow, Russia). The specialized program REST 2009 (developed by M. Pfaffl and QIAGEN) was used for gene expression analysis. The housekeeping gene Gapdh was used as an endogenous control.
9
Quantifying NOX4 mRNA Expression in Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analysis of NOX4 expression was performed by quantitative Reverse Transcription Polimerase Chain Reaction (qRT–PCR). Following dissection, brain tissues were immediately placed in the RNAlater buffer (Qiagen, Wrocław, Poland) to inhibit RNA degradation. RNA was extracted from tissue samples using an RNeasy Lipid Tissue Mini Kit (Qiagen, Poland), according to the manufacturer’s instructions. Then, 1 μg of extracted RNA was prepared for analysis using a FirstStrand cDNA synthesis kit and oligo-dT primers (ThermoFisher, Warszawa, Poland). To quantify mRNA levels, qRT–PCR was performed using an ABI 7500Fast and Power Master SYBR Green PCR Master Mix (ThermoFisher, Poland). The following primer pairs were used: GAPDH forward: ATGACTCTACCCACGGCAAG, reverse: CTGGAAGATGGTGATGGGTT; NOX4 forward: AGTCAAACAGATGGGA, reverse: TGTCCCATATGAGTTGTT.
10
Worm Germline Dissection and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Worms were synchronized by plating arrested L1 larvae and allowed to grow to young adults. N2 hermaphrodites from non-mated plates or N2 males were dissected in a depression slide containing 0.5 mM levamisole in M9 buffer. Heads were severed below the pharynx with a 25G1½ needle, and intact extruded germ lines were separated from the body. The ‘female’ germline was cut to include everything except the spermatheca, while the male germline was cut to include spermatids, although some were released into the buffer when dissected. Germline pieces were visually assessed and cut under dissecting microscope. Samples were immediately immersed in RNALater buffer (Qiagen, Germantown, MD) to preserve the RNA and then transferred using a mouth pipet to the cap of a 0.2 mL microcentrifuge tube containing additional RNALater. Samples were pooled in the same cap until sufficient quantities were collected and then stored at -80 °C. Once samples had been collected in triplicate, RNA was extracted using the Qiagen RNeasy Micro kit according to the manufacturer’s protocol with an on-column DNase I treatment and eluted in RNase-free water. The quantity and quality of RNA recovered were assessed on an Agilent Bioanalyzer (Santa Clara, California).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!