Dharmafect 4

Manufactured by Thermo Fisher Scientific

Sourced in United States

DharmaFECT 4 is a cationic lipid-based transfection reagent designed for efficient delivery of plasmid DNA, siRNA, and other nucleic acids into a variety of mammalian cell types. It provides high transfection efficiency and minimal cytotoxicity.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

DharmaFECT (82 citations) DharmaFECT 4 Transfection Reagent (23 citations) DharmaFECT 4 reagent (5 citations) DharmaFECT formulation 4 (3 citations)

36 protocols using dharmafect 4

Knockdown of IGF-1R and CDK1 in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

IGF-1R- and mock-siRNA (Thermo Fisher Scientific, Waltham, MA) were transfected into Hep3B cells at 40% confluence by adding 8 μL Dharmafect 4 (Invitrogen, Carlsbad, CA) and 40 nmol siRNA to 2 mL antibiotic-free medium. CDK1- and mock-siRNA (Qiagen, Hilden, Germany) were transfected into MCF-7 cells by adding 12 μL of oligofectamine (Invitrogen, Carlsbad, CA) and 10 nmol of siRNA to 2 mL antibiotic-free medium. After 48 h (IGF-1R siRNA) or 72 h (CDK1 siRNA) the cells were washed with fresh medium and then treated with PPP or vehicle for an additional 24 h before analysis. The knockdown efficiency was 80-90% as assessed by Western blotting.

Waraky A., Akopyan K., Parrow V., Strömberg T., Axelson M., Abrahmsén L., Lindqvist A., Larsson O, & Aleem E. (2014). Picropodophyllin causes mitotic arrest and catastrophe by depolymerizing microtubules via Insulin-like growth factor-1 receptor-independent mechanism. Oncotarget, 5(18), 8379-8392.

+ Open protocol

+ Expand

High-Throughput Transfection Optimization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were plated at 5,500 cells per well in a 96-well imaging plate one day prior to transfection. siRNAs were diluted to 0.25 µM in OptiMEM (Invitrogen) and Dharmafect 4 at 1/100 in OptiMEM. Equal volumes of the solutions were incubated together for 30 min at room temperature, diluted with 4× volume antibiotic free medium and plated onto the cells. Cells were transfected for 72 hours followed by calcium imaging. Additional sets of wells were transfected for Western analysis of targeted proteins.

van Ginkel P.R., Yan M.B., Bhattacharya S., Polans A.S, & Kenealey J.D. (2015). Natural Products Induce a G Protein-Mediated Calcium Pathway Activating p53 in Cancer Cells. Toxicology and applied pharmacology, 288(3), 453-462.

+ Open protocol

+ Expand

Endothelial Cell Culture and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

PAECs (Lonza, Basel, Switzerland) were cultured at 37 °C in a 5% CO₂ incubator in endothelial cell growth medium-2 (Lonza), 1% penicillin–streptomycin (Welgene, Daegu, Republic of Korea), and MycoZap (Lonza). For the experimental treatments, PAECs were grown to 70–90% confluency. Lenti-HEK293X cells were cultured in Dulbecco’s modified Eagle’s medium (HyClone, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin–streptomycin (Welgene). Small interfering RNA (siRNA) (Stealth siRNA; Invitrogen, Grand Island, NY, USA) was transfected using Lipofectamine RNAi MAX (Invitrogen) or DharmaFECT4 according to the manufacturer’s instructions. Plasmid DNAs were transfected into cells using Lipofectamine 2000 (Invitrogen).

Lee D., Lee H., Jo H.N., Yun E., Kwon B.S., Kim J, & Lee A. (2024). Endothelial periostin regulates vascular remodeling by promoting endothelial dysfunction in pulmonary arterial hypertension. Animal Cells and Systems, 28(1), 1-14.

+ Open protocol

+ Expand

Myc Silencing Modulates IL-1β Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

INS-1 cells (0.8 × 10⁶ cells/well for Western blotting and 0.075 × 10⁶ cells/well for Cell Death Detection Assay) were transfected with siRNA directed against rat Myc (Sigma), negative control siRNA (mission siRNA universal negative control, Sigma), or vehicle. The cells were transfected using DharmaFECT4 (Thermo Scientific, Denmark) according to the manufacturer's protocol, with a final concentration of siRNA of 50 nmol/L. The cells were incubated for 22 h with siRNA or vehicle and then exposed to IL-1β (150 pg/mL) or left nonexposed for 24 h. Protein was isolated and analyzed by Western blotting and apoptotic cell death was measured by the Cell Death Detection ELISA^PLUS (Roche, Hvidovre, Denmark).

Prause M., Mayer C.M., Brorsson C., Frederiksen K.S., Billestrup N., Størling J, & Mandrup-Poulsen T. (2016). JNK1 Deficient Insulin-Producing Cells Are Protected against Interleukin-1β-Induced Apoptosis Associated with Abrogated Myc Expression. Journal of Diabetes Research, 2016, 1312705.

+ Open protocol

+ Expand

Characterization of Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human Breast cancer cell lines, human mammary gland epithelia cell line, and human embryonic kidney cell line were purchased from American Type Culture Collection (ATCC) and Characterized Cell Line Core Facility (MD Anderson Cancer Center). siRNA and plasmid transfections were performed using DharmaFECT4 (Thermo Scientific) and Lipofectamine^® 3000 (Life Technologies). Lentiviruses were produced in HEK293T cells with ViraPower Lentiviral Expression System. All of the cell lines were free of mycoplasma contamination tested by vendors using MycoAlert kit from Lonza. No cell lines used in this study are found in the database of commonly misidentified cell lines (ICLAC and NCBI Biosample) based on short tandem repeats (STR) profiling performed by vendors.

Lin A., Li C., Xing Z., Hu Q., Liang K., Han L., Wang C., Hawke D.H., Wang S., Zhang Y., Wei Y., Ma G., Park P.K., Zhou J., Zhou Y., Hu Z., Zhou Y., Marks J.R., Liang H., Hung M.C., Lin C, & Yang L. (2016). The LINK-A lncRNA Activates Normoxic HIF1α Signaling in Triple-negative Breast Cancer. Nature cell biology, 18(2), 213-224.

+ Open protocol

+ Expand

Gene Silencing and miRNA Modulation in Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

PC-3M-luc2 cells and Du145 cells were cultured in EMEM (Lonza, 12–125) supplemented with 10% FCS, 1% L-glutamine (Lonza, BE17-605E) and 1 % penicillin-streptomycin (Lonza, DE17-602E). MDA-MB-231 and PANC-1 cells were cultured in DMEN (Lonza, BE12-614F), T778 cells in RPMI 1640 (Gibo, 31870025), each supplemented with 10% FCS, 1% L-glutamine (Lonza, BE17-605E) and 1 % penicillin-streptomycin (Lonza, DE17-602E). RNAi knockdown was performed using Dharmafect 2 (Thermo Scientific, T-2002-01) in PC- 3M-luc2 cells, PANC1 cells and MDA-MB-231 cells, and Dharmafect 4 (Thermo Scientific, T-2004-01) in Du145 cells using 25 nM siRNA (final concentration) according to the manufacturer′s instruction. The following siRNAs were used for RNAi-mediated knockdown:

siCtrl 5′-GAAAGUCCUAGAUCCACACGCAAAU-3′.

siPRK1 5′-GAACAUGAUCCAGACCUACAGCAAU-3′.

sip38 5′-CAGACCATTTCAGTCCATCATTCAT-3′.

siPXN 5′-CATACCCAACTGGAAACCACACATA-3′.

siELK1 5′-CACATCCCTTCTATCAGCGTGGATG-3′.

The following miRNAs were used for stable miRNA expression:

miR-Ctrl 5′-GAAATCGCTGATTTGTGTAGTCGTTTTGG CCACTGACTGACGACT ACACATCAGCGA TTT-3′.

miR-SPAG9 5′-GATTTCTGGTGGTTTATCCATCGTTTTGG CCACTGACTGACGA TGGATACCACCAG AAAT-3′.

miR-NT5E 5′-GTACACGGTGAACCAGATAGTGGTTTTG GCCACTGACTGACCACTATCTTTCACCG TGTA-3′.

miR-NEDD9 5′-GTAATGAGCACAGCCACCATCCGTTTTG GCCACTGACTGACGGATGGTGTGTGCTC ATTA-3′.

Jilg C.A., Ketscher A., Metzger E., Hummel B., Willmann D., Rüsseler V., Drendel V., Imhof A., Jung M., Franz H., Hölz S., Krönig M., Müller J.M, & Schüle R. (2014). PRK1/PKN1 controls migration and metastasis of androgen-independent prostate cancer cells. Oncotarget, 5(24), 12646-12664.

+ Open protocol

+ Expand

Cell Culture and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa S3 and 293T cells were cultured in DMEM supplemented with 10% FBS. Lymphoblasts were cultured in RPMI 1640 supplemented with 10% FBS. Lipofectamine 2000 (Life Technologies, 11668019) was used for all cDNA transfection experiments. Dharmafect 4 (Thermo, T-2004-01) was used for all siRNA transfections. All siRNAs were siGENOME pools purchased from Dharmacon/Thermo and used at 25 or 50 nM. Cells were assayed 72 hr after transfection. For transduction, 293T cells were transfected with the appropriate target plasmid and packaging constructs (lentiviral or retroviral) overnight; 48 hr later, viral supernatant was collected. Cells were transduced in the presence of 5 μg/mL Polybrene and selected for 3-7 days depending on the selection marker.

Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J, & Artandi S.E. (2014). Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell, 159(6), 1389-1403.

+ Open protocol

+ Expand

CTCF Depletion via siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were trypsinized to reverse transfect with 25 nM of CTCF-specific or scrambled TARGETplus Smartpool siRNAs (Horizon, USA) using DharmaFECT4 (20% of amount recommended by the manufacturer’s protocol; ThermoFisher). Cells with no siRNA (un-treated; UT) were also assayed to assess lethality of CTCF depletion.

D’Arienzo V., Ferguson J., Giraud G., Chapus F., Harris J.M., Wing P.A., Claydon A., Begum S., Zhuang X., Balfe P., Testoni B., McKeating J.A, & Parish J.L. (2020). The CCCTC-binding factor CTCF represses hepatitis B virus enhancer I and regulates viral transcription. Cellular microbiology, 23(2), e13274.

+ Open protocol

+ Expand

Macrophage Transcriptome Profiling After CD58 and TAGAP Silencing

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human monocyte-derived macrophages were derived as described previously^{38 (link)}. Macrophages from five different volunteers were transfected with CD58 siRNA (L-004538-00-0005), TAGAP siRNA (L-008711-01-0005) or control siRNA (D-001810-10-20) by Dharmafect 4 for 2 days (Thermo Scientific). Total RNA was isolated at 6 hours and 24 hours, and global gene expression was profiled using Illumina Human HT-12 Expression BeadChip^{39 (link)}. Differentially expressed genes by at least 1.25-fold between control and CD58 siRNA cells were subjected to pathway enrichment analysis using GeneNetwork analysis^{40 (link)}. After siRNA transfection, macrophages were exposed to live C. albicans at multiplicity of infection (MOI)= 1 for 24 hours, after which the phagocytosis and fungal outgrowth was determined by microscopy. The role of fungal germination was assessed by using the yeast-locked Hgc1-deficient C. albicans strain (provided by Dr. Bernhard Hube, Jena University). Cytokine concentrations were determined by ELISA.

Kumar V., Cheng S.C., Johnson M.D., Smeekens S.P., Wojtowicz A., Giamarellos-Bourboulis E., Karjalainen J., Franke L., Withoff S., Plantinga T.S., van de Veerdonk F.L., van der Meer J.W., Joosten L.A., Bochud P.Y., Marchetti O., Perfect J.R., Xavier R., Kullberg B.J., Wijmenga C, & Netea M.G. (2014). Immunochip SNP array identifies novel genetic variants conferring susceptibility to candidemia. Nature communications, 5, 4675.

+ Open protocol

+ Expand

Silencing HDAC4 and HDAC5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

ON-TARGETplus pooled siRNAs targeting human HDAC4 (J-003497), HDAC5 (J-003498), and nontargeting control siRNA 2 (D-001810-02) and DharmaFect 4 (T-2004-03) were purchased from GE Dharmacon. First, 70 nM of siRNA and 0.2% DharmaFect 4 were diluted in Opti-MEM (Thermo Fisher Scientific) individually and then mixed together for 20 minutes at room temperature. Cells were then laid on top of siRNA-DharmaFECT mixture. Cells were lysed to determine target gene expression and prepared for luciferase activity assay 72 hours after transfection.

Lu Z., Mao W., Yang H., Santiago-O’Farrill J.M., Rask P.J., Mondal J., Chen H., Ivan C., Liu X., Liu C.G., Xi Y., Masuda K., Carrami E.M., Chen M., Tang Y., Pang L., Lakomy D.S., Calin G.A., Liang H., Ahmed A.A., Vankayalapati H, & Bast RC J.r. (2022). SIK2 inhibition enhances PARP inhibitor activity synergistically in ovarian and triple-negative breast cancers. The Journal of Clinical Investigation, 132(11), e146471.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!