Lymphoblastoid cell lines were established from indicated patients using standard protocols. RNA extraction was followed by cDNA synthesis and real-time reverse-transcriptase PCR (Applied Biosystems 7500 Fast Real-Time PCR System) using exon–exon spanning primers to avoid genomic DNA amplification. Primer sequences were 5′-TGCAGTCCATCAGATCCAAG-3′ and 5′-GCACCGACTGACACAATTCA-3′. QuantiTect SYBR Green mix (Qiagen, Limburg, Netherlands) was used for quantification, and the deltaCt method was utilized to calculate fold difference compared with normal controls (with GAPDH for internal normalization). All reactions were performed using at least two independent runs, in triplicate each time, then normalized to GAPDH using the built-in software (v2.0.5) to generate the relative quantification.
Quantitect sybr green mix
Manufactured by Qiagen
Sourced in United States
The QuantiTect SYBR Green Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains all the necessary components, including a SYBR Green-based detection chemistry, for efficient and sensitive gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Dna engine opticon 2 machine, by Bio-Rad (3 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Quantstudio 3, by Thermo Fisher Scientific (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
6 protocols using quantitect sybr green mix
1
Quantifying Gene Expression in Lymphoblasts
2
Quantitative RT-PCR for NQO1 Expression
3
Quantitative Real-Time PCR Assay for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR reaction mixtures were prepared containing 0.25 μL of cDNA samples and QuantiTect SYBR Green mix (Qiagen), 1 μM forward primer qRT-ssnAF and qRT-ssnAR reverse primer (Supplementary Table 2 ) in a total volume of 20 μL. Reactions were performed in triplicate using QuantStudio 3 (ThermoFisher Scientific, Waltham, Massachusetts, USA) with the following thermocycling program: initial denaturation at 95 °C for 2 min and 40 cycles of amplification at 95 °C for 15 s, 55 °C for 10 s and 72 °C for 30 s. The Comparative CT Method (ΔΔCT) was used to analyze RT-qPCR data, and data were normalized to the 16 S rRNA gene as a reference (Supplementary Table 2 , qRT-16S-F and qRT-16S-F). RT-qPCR reactions were validated using melt curve analysis.
4
Quantitative PCR Primer Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer evaluation was performed in 20 μl final volumes. Experiments involving plasma DNA were performed in 10 μl final volumes due to sample limitations. Reaction mixes consisted of: Quantitect SYBR Green Mix (Qiagen, UK), 300 nM primers, nuclease-free H2O and 2 μl of DNA.
Cycling parameters consisted of: a hold at 95 °C for 15 min, 40 cycles of 94 °C for 15 sec and 57 °C for 30 sec, and extension at 72 °C for 30 sec. Fluorescence was monitored during the 72 °C step, using the FAM channel. Melt curve analysis was performed between 60 °C to 97 °C at a ramp rate of 0.2 °C/sec.
Cycling parameters consisted of: a hold at 95 °C for 15 min, 40 cycles of 94 °C for 15 sec and 57 °C for 30 sec, and extension at 72 °C for 30 sec. Fluorescence was monitored during the 72 °C step, using the FAM channel. Melt curve analysis was performed between 60 °C to 97 °C at a ramp rate of 0.2 °C/sec.
5
Quantification of wild-type p53 in sarcomas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from sarcomas, breast carcinomas and control tails using DNeasy Blood and Tissue kit (Qiagen, 69506) and quantified by spectrophotometer. Quantitative real-time PCR was performed in duplicates with QuantiTect SYBR Green Mix (Qiagen, Germantown, MD, USA, 204143) on the MJ Research DNA Engine Opticon 2 machine, using 8 ng genomic DNA and the following mouse wtp53 allele-specific primer pairs: 5′-ACAGCGTGGTGGTACCTTAT-3′ (forward) and 5′-TATACTCAGAGCCGGCCT-3′ (reverse). These wtp53 primers anneal to mouse exons 5 and 6 and do not recognize the humanized mutp53 allele. For all samples, the wtp53 signal was normalized to the Rosa26 signal measured by the following primers: 5′-AAAGTCGCTCTGAGTTGTTAT-3′ (forward) and 5′-GGAGCGGGAGAAATGGATATG-3′ (reverse).
6
Quantitative RT-PCR for NQO1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen) and 2 µg was reverse-transcribed with random primers and SuperScript II Reverse Transcriptase (Invitrogen Cat # 18064-014). Real-time qRT-PCR was performed in duplicates with QuantiTect SYBR Green Mix (Qiagen Cat # 204143) using the MJ Research DNA Engine Opticon 2 machine. Primers for mouse NQO1 were: 5’ TGGCCGAACACAAGAAGCTG 3’ (forward), 5’ GCTACGAGCACTCTCTCAAACC 3’ (reverse). NQO1 expression was normalized to the housekeeping gene HPRT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!